Ваз 1115: Купить LADA (ВАЗ) 2115 с пробегом: продажа автомобилей Лада 2115 б/у

Содержание

21100104102000 Ремень привода вспомогательных агрегатов LADA

Год 01.12.2009, 01.05.2009, 01.05.2007, 01.01.2014, 01.01.2013
Модификации 21728 PRIORA (КУПЕ), 21123 (КУПЕ), 21722-30, 21723-31, 21723-33, 21725-31, 21725-33, 21725-34 PRIORA FL (ХЭТЧБЕК), 21702-30, 21703-31, 21703-33, 21705-31, 21705-33, 21705-34 PRIORA FL (СЕДАН), 21721-00, 21722-00, 21722-20, 21723-01, 21723-02, 21723-03, 21723-21, 21723-23 PRIORA (ХЭТЧБЕК), 21701-00, 21702-00, 21702-20, 21703-01, 21703-02, 21703-03, 21703-21, 21703-23 PRIORA (СЕДАН), 21713-01, 21713-02, 21713-03, 21713-21, 21713-23 PRIORA (УНИВЕРСАЛ), 21713-31, 21713-33, 21715-31, 21715-33, 21715-34 PRIORA FL (УНИВЕРСАЛ)
Производитель PRIORA (Приора 21728), 2111, 2110, 2112, 21123, PRIORA (Приора 2172), PRIORA (Приора 2170), PRIORA (Приора 2171)

Информация для покупателей

Информация по аналогам имеет исключительно справочный характер и не гарантирует совместимость с вашим автомобилем! Если Вы не уверены в том, что выбранная Вами деталь подходит к Вашему транспортному средству - обратитесь за помощью к менеджеру по подбору запчастей. Цены указаны при заказе физическими лицами на сайте.

Фильтр

  • срок доставки
  • Доступное количество
  • Сбросить

Размещённая на сайте информация (описание, технические характеристики а так же фотографии) приведена для ознакомления и не является публичной офертой. Не может служить основанием для предъявления претензий в случае изменения характеристик, комплектности и внешнего вида товара производителем без уведомления.

 

Почему покупают 21100104102000 Ремень привода вспомогательных агрегатов LADA у нас:

«Автолюбитель» — крупнейший автомобильный супермаркет на Юге Кузбасса. Он открыт в 1987 году и с тех пор является центром автомобильной торговли в городе Новокузнецке. Являемся поставщиком товарной марки LADA на территории Новокузнецка, Кемеровской области РФ, у нас несколько складов по наличию и имеем запчасти на редкие автомобили и готовы дать хорошую цену на Ремень привода вспомогательных агрегатов 21100104102000 бренда LADA.

На все детали бренда LADA предоставляется гарантия.

 

Цена на 21100104102000 Ремень привода вспомогательных агрегатов:

Получить цену на оригинальную или аналоговую запчасть Ремень привода вспомогательных агрегатов, и знать лучший срок доставки, которая будет удобна для вас, можно позвонив нашему менеджеру. Наши продавцы-консультанты всегда рады видеть Вас и всегда готовы оказать Вам квалифицированную услугу.

Телефон: 

+7 (906) 924-13-37

Или отправить VIN-запрос на нашем ресурсе и менеджер вам сам перезвонит.

 
Как заказать LADA 21100104102000:

1. Определиться со сроками, выбрать количество и добавить Ремень привода вспомогательных агрегатов в корзину.

2. Оформить заказ, выбрать тип получения товара и тип оплаты.

3. Если товар в наличии - Вы можете буквально сразу получить свой товар в нашей точке выдачи.

CONTIBELT 6PK1115 Ремень поликлиновый 6PK1115 1118-1041020-03 GL.TB.1.4 А/С с ГУР - цена и аналоги:

 

Информация для покупателей

Просим вас быть бдительными при переводе денежных средств третьим лицам.

Фильтр

  • срок доставки
  • Доступное количество
  • Сбросить

Представленные на сайте цены товара CONTIBELT 6PK1115 Ремень поликлиновый 6PK1115 1118-1041020-03 GL.TB.1.4 А/С с ГУР указаны с учетом доставки до пункта самовывоза в городе Новокузнецк.

Для уточнения стоимости доставки по России Вы можете обратиться к менеджеру нашего интернет-магазина по указанным контактам. Для самостоятельного рассчета доставки воспользуйтесь нашим онлайн-калькулятором рассчета доставки. 

 

 

 

Чтобы купить CONTIBELT 6PK1115:

1. Определитесь со сроками, выберите необходимое количество и добавьте CONTIBELT 6PK1115 в корзину.

2. Оформите заказ, следуя подсказкам в корзине.

3. Оплатите заказ, выбрав удобный способ оплаты. Напоминаем, что мы работаем только по 100% предоплате.

4. Если товар в наличии - Вы можете буквально сразу же получить его в нашем пункте самовывоза.

Каждая запчасть имеет свою применимость к определённым маркам автомобиля. Обязательно перед оформлением заказа убедитесь, что CONTIBELT 6PK1115 Ремень поликлиновый 6PK1115 1118-1041020-03 GL.TB.1.4 А/С с ГУР подходит к Вашему автомобилю.

Информация по заменителям (дубликатам, заменам, аналогам) имеет исключительно справочный характер и не гарантирует совместимость с вашим автомобилем! Если Вы не уверены в том, что выбранная Вами деталь подходит к Вашему транспортному средству - обратитесь за помощью к менеджеру по подбору запчастей.

Размещённая на сайте информация (описание, технические характеристики, а так же фотографии) приведена для ознакомления и не является публичной офертой. Не может служить основанием для предъявления претензий в случае изменения характеристик, комплектности и внешнего вида товара производителем без уведомления.

Все цвета автомобильных эмалей и красок KUDO на одной странице

KU-70090
1К черный матовыйВАЗ dfp ЛАДА Lada vaz

KU-70100
Триумф 100
металликВАЗ dfp ЛАДА Lada vaz

KU-70104
Калина 104
металликВАЗ dfp ЛАДА Lada vaz

KU-70105
Франкония 105
металликВАЗ dfp ЛАДА Lada vaz

KU-70107
Баклажан 107ВАЗ dfp ЛАДА Lada vaz

KU-70110
Рубин 110 ВАЗ dfp ЛАДА Lada vaz

KU-70116
Коралл 116
металликВАЗ dfp ЛАДА Lada vaz

KU-70118
Кармен 118ВАЗ dfp ЛАДА Lada vaz

KU-70119
Магма 119
МеталликВАЗ dfp ЛАДА Lada vaz

KU-70121
Реклама 121ВАЗ dfp ЛАДА Lada vaz

KU-70124
Огненно-красный 124
металликВАЗ dfp ЛАДА Lada vaz

KU-70125
Антарес 125
металликВАЗ dfp ЛАДА Lada vaz

KU-70127
Вишня 127ВАЗ dfp ЛАДА Lada vaz

KU-70128
Искра 128
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70129
Виктория 129
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70132
Вишневый сад 132
металликВАЗ dfp ЛАДА Lada vaz

KU-70137
Лава 137
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70140
Яшма 140ВАЗ dfp ЛАДА Lada vaz

KU-70145
Аметист 145
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70150
Дефиле 150
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70152
Паприка 152
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70165
Коррида 165ВАЗ dfp ЛАДА Lada vaz

KU-70170
Торнадо 170 ВАЗ dfp ЛАДА Lada vaz

KU-70180
Гранат 180 ВАЗ dfp ЛАДА Lada vaz

KU-70190
Калифорнийский мак 190
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70192
Портвейн 192
металликВАЗ dfp ЛАДА Lada vaz

KU-70193
Пламя 193
металликВАЗ dfp ЛАДА Lada vaz

KU-70195

Сердолик 195
металликВАЗ dfp ЛАДА Lada vaz

KU-70201
Белый 201ВАЗ dfp ЛАДА Lada vaz

KU-70202
Снежно-белый 202ВАЗ dfp ЛАДА Lada vaz

KU-70204
Айсберг 204ВАЗ dfp ЛАДА Lada vaz

KU-70206
Талая вода 206
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70208
Охра золотистая 208ВАЗ dfp ЛАДА Lada vaz

KU-70215
Сафари 215 ВАЗ dfp ЛАДА Lada vaz

KU-70218
Аэлита 218

металликВАЗ dfp ЛАДА Lada vaz

KU-70225
Желтый 225ВАЗ dfp ЛАДА Lada vaz

KU-70228
Чайная роза 228ВАЗ dfp ЛАДА Lada vaz

KU-70230
Жемчуг 230
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70233
Белый 233 ВАЗ dfp ЛАДА Lada vaz

KU-70235
Бежевый 235ВАЗ dfp ЛАДА Lada vaz

KU-70236
Серо-бежевый 236ВАЗ dfp ЛАДА Lada vaz

KU-70239
Невада 239 ВАЗ dfp ЛАДА Lada vaz

KU-70240
Белое облако 240ВАЗ dfp ЛАДА Lada vaz

KU-70242
Серый базальт 242
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70245
Золотая нива 245
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70246
Ангкор 246
металликВАЗ dfp ЛАДА Lada vaz

KU-70257
Звездная пыль 257
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70262
Бронзовый век 262ВАЗ dfp ЛАДА Lada vaz

KU-70265
Пума 265
металликВАЗ dfp ЛАДА Lada vaz

KU-70270
Нефертити 270
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70276
Приз 276
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70280
Мираж 280
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70281
Кристалл 281
металликВАЗ dfp ЛАДА Lada vaz

KU-70283
Кашемир 283ВАЗ dfp ЛАДА Lada vaz

KU-70286
Опатия 286
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70290
Южный крест 290
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70299
Такси 299ВАЗ dfp ЛАДА Lada vaz

KU-70301
Серебристая ива 301
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70302
Лиана 302 ВАЗ dfp ЛАДА Lada vaz

KU-70303
Хаки 303 ВАЗ dfp ЛАДА Lada vaz

KU-70305
Аспарагус 305
металликВАЗ dfp ЛАДА Lada vaz

KU-70307
Зеленый сад 307ВАЗ dfp ЛАДА Lada vaz

KU-70308
Осока 308
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70310
Валюта 310
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70311
Игуана 311
металликВАЗ dfp ЛАДА Lada vaz

KU-70322
Колумбийская зелень 322
металликВАЗ dfp ЛАДА Lada vaz

KU-70325
Липа зеленая 325ВАЗ dfp ЛАДА Lada vaz

KU-70331
Золотой лист 331
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70347
Золото инков 347
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70360
Сочи 360
металликВАЗ dfp ЛАДА Lada vaz

KU-70363
Цунами 363
металликВАЗ dfp ЛАДА Lada vaz

KU-70370
Корсика 370
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70371
Амулет 371
металликВАЗ dfp ЛАДА Lada vaz

KU-70372
Криптон 372
металликВАЗ dfp ЛАДА Lada vaz

KU-70377
Мурена 377ВАЗ dfp ЛАДА Lada vaz

KU-70383
Ниагара 383
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70385
Изумруд 385
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70387
Папирус 387
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70391
Робин Гуд 391ВАЗ dfp ЛАДА Lada vaz

KU-70394
Темно-зеленый 394ВАЗ dfp ЛАДА Lada vaz

KU-70399
Табачный 399
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70400
Босфор 400ВАЗ dfp ЛАДА Lada vaz

KU-70403
Монте-Карло 403ВАЗ dfp ЛАДА Lada vaz

KU-70404
Петергоф 404 ВАЗ dfp ЛАДА Lada vaz

KU-70408
Чароит 408
металликВАЗ dfp ЛАДА Lada vaz

KU-70412
Регата 412
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70413
Ледяной 413
металликВАЗ dfp ЛАДА Lada vaz

KU-70415
Электрон 415
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70416
Фея 416
металликВАЗ dfp ЛАДА Lada vaz

KU-70417
Пицунда 417ВАЗ dfp ЛАДА Lada vaz

KU-70418
Голубая планета 418
металликВАЗ dfp ЛАДА Lada vaz

KU-70419
Опал 419
металликВАЗ dfp ЛАДА Lada vaz

KU-70420
Балтика 420ВАЗ dfp ЛАДА Lada vaz

KU-70421
Афалина 421
металликВАЗ dfp ЛАДА Lada vaz

KU-70423
Гейзер 423
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70425
Адриатика 425ВАЗ dfp ЛАДА Lada vaz

KU-70426
Мускари 426
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70427
Серо-голубой 427ВАЗ dfp ЛАДА Lada vaz

KU-70428
Медео 428 ВАЗ dfp ЛАДА Lada vaz

KU-70429
Персей 429
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70440
Атлантика 440ВАЗ dfp ЛАДА Lada vaz

KU-70441
Индиго 441ВАЗ dfp ЛАДА Lada vaz

KU-70446
Сапфир 446
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70447
Синяя полночь 447 ВАЗ dfp ЛАДА Lada vaz

KU-70448
Рапсодия 448
металликВАЗ dfp ЛАДА Lada vaz

KU-70449
Океан 449ВАЗ dfp ЛАДА Lada vaz

KU-70453
Капри 453
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70456
Темно-синий 456ВАЗ dfp ЛАДА Lada vaz

KU-70460
Аквамарин 460
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70464
Валентина 464 ВАЗ dfp ЛАДА Lada vaz

KU-70473
Юпитер 473
металликВАЗ dfp ЛАДА Lada vaz

KU-70478
Слива 478
металликВАЗ dfp ЛАДА Lada vaz

KU-70480
Бриз 480 ВАЗ dfp ЛАДА Lada vaz

KU-70481
Синяя 481ВАЗ dfp ЛАДА Lada vaz

KU-70482
Черника 482
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70483
Сириус 483
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70487
Лагуна 487
металликВАЗ dfp ЛАДА Lada vaz

KU-70490
Астероид 490
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70492
Блюз 492
металликВАЗ dfp ЛАДА Lada vaz

KU-70495
Лунный свет 495
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70496
Фантом 496
металликВАЗ dfp ЛАДА Lada vaz

KU-70497
Васильковый 497 ВАЗ dfp ЛАДА Lada vaz

KU-70498
Лазурно-синий 498
металликВАЗ dfp ЛАДА Lada vaz

KU-70499
Ривьера 499
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70513
Черный жемчуг 513
металликВАЗ dfp ЛАДА Lada vaz

KU-70515
Изабелла 515
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70564
Кипарис 564ВАЗ dfp ЛАДА Lada vaz

KU-70601
Черный 601 ВАЗ dfp ЛАДА Lada vaz

KU-70602
Авантюрин 602
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70606
Млечный путь 606
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70608
Плутон 608
металликВАЗ dfp ЛАДА Lada vaz

KU-70615
Полюс мира 615
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70620
Мускат 620
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70626
Мокрый асфальт 626
металликВАЗ dfp ЛАДА Lada vaz

KU-70627
Жимолость 627
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70628
Нептун 628
металликВАЗ dfp ЛАДА Lada vaz

KU-70630
Кварц 630
металликВАЗ dfp ЛАДА Lada vaz

KU-70633
Борнео 633ВАЗ dfp ЛАДА Lada vaz

KU-70637
Черный шоколад 637
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70640
Серебристый 640
металликВАЗ dfp ЛАДА Lada vaz

KU-70650
Совиньон 650
металликВАЗ dfp ЛАДА Lada vaz

KU-70651
Черный трюфель 651
металликВАЗ dfp ЛАДА Lada vaz

KU-70655
Викинг 655
металликВАЗ dfp ЛАДА Lada vaz

KU-70660
Альтаир 660
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70665
Космос 665
металлик ВАЗ dfp ЛАДА Lada vaz

KU-70671
Светло-серый 671 ВАЗ dfp ЛАДА Lada vaz

KU-70672
Пантера 672
металликВАЗ dfp ЛАДА Lada vaz

KU-70676
Черная жемчужина 676
металликВАЗ dfp ЛАДА Lada vaz

KU-70682
Гранта 682
металликВАЗ dfp ЛАДА Lada vaz

KU-70690
Снежная королева 690
металликВАЗ dfp ЛАДА Lada vaz

KU-70691
Платина 691
металликВАЗ dfp ЛАДА Lada vaz

KU-70790
Кориандр 790
МеталликВАЗ dfp ЛАДА Lada vaz

KU-70963
Зеленый 963
металликВАЗ dfp ЛАДА Lada vaz

KU-71302
Бергамот 302
металлик ВАЗ dfp ЛАДА Lada vaz

KU-71610
Рислинг 610
металлик ВАЗ dfp ЛАДА Lada vaz

ВАЗ | Оптовый гипермаркет автозапчастей «Кортик»

5-я передача в сб 07 н/о, 2123 "ВАЗ" (ФИР УП)

Артикул: 2123-1701154-10

Код товара: 00000055929

1 687 ₽ Узнать оптовую цену В наличии
5-я передача в сб 07 н/о, 2123 "Волгоград" (уп)

Артикул: 2107-1701157-10

Код товара: 00000028649

662 ₽ Узнать оптовую цену В наличии
5-я передача в сб 07 с/о (со втулкой) "Волгоград" (уп)

Артикул: 2107-1701157

Код товара: 00000028650

683 ₽ Узнать оптовую цену В наличии
Аварийное зажигание АЗ-1 "ТЕК" (2108-10, Ока)

Артикул: 5001/АЗ-1

Код товара: 00000058315

184 ₽ Узнать оптовую цену В наличии
Аварийное зажигание АЗ-1 (2108-10, Ока) "ОРИОН"

Артикул: 5001 АЗ-1

Код товара: 00001975584

168 ₽ Узнать оптовую цену Отсутствует
Адсорбер 08, 2110 инж с клап

Артикул: 2112-1164010-12

Код товара: 00000028653

714 ₽ Узнать оптовую цену В наличии
Адсорбер 21103, ГАЗель Бизнес (4216) без датчика Е-3

Артикул: 21103-1164010-02

Код товара: 00001984322

578 ₽ Узнать оптовую цену В наличии
Адсорбер 2170 \

Артикул: 2170-1164010

Код товара: 00000053523

630 ₽ Узнать оптовую цену Отсутствует
Адсорбер 2190

Артикул: 2190-1164010

Код товара: 00000066771

578 ₽ Узнать оптовую цену В наличии
Амортизатор 01 зад "Hofer" (масл)

Артикул: HF505105

Код товара: 00000058725

567 ₽ Узнать оптовую цену Отсутствует
Амортизатор 01 зад "Riginal" (масл)

Артикул: 2101-2915402

Код товара: 00000057509

586 ₽ Узнать оптовую цену В наличии
Амортизатор 01 зад "Белмаг" (масл) \ АКЦИЯ

Артикул: 9496

Код товара: 00000052825

546 ₽ Узнать оптовую цену Отсутствует
Амортизатор 01 зад "СААЗ" (ФИР УП) (20)

Артикул: 2101-2915402-06

Код товара: 00000028657

707 ₽ Узнать оптовую цену В наличии
Амортизатор 01 зад "СААЗ" (ФИР УП) (газ)

Артикул: 2101-2915006-10

Код товара: 00000028658

755 ₽ Узнать оптовую цену В наличии
Амортизатор 01 зад "САН-Д" (масл)

Артикул: 2101-2915402

Код товара: 00001979164

441 ₽ Узнать оптовую цену Отсутствует
Амортизатор 01 зад "Скопин-НИКОН" (20) (АКЦИЯ) ТОП

Артикул: 2101-2915006-02

Код товара: 00000068255

435 ₽ Узнать оптовую цену В наличии
Амортизатор 01 зад "Фенокс" масл (12)

Артикул: А12175C3

Код товара: 00000028659

676 ₽ Узнать оптовую цену В наличии
Амортизатор 01 пер "Hofer" (масл)

Артикул: HF505103

Код товара: 00000058724

557 ₽ Узнать оптовую цену Отсутствует
Амортизатор 01 пер "Hola"

Артикул: S-401

Код товара: 073414

578 ₽ Узнать оптовую цену Отсутствует
Амортизатор 01 пер "Riginal" (масл)

Артикул: 2101-2905402

Код товара: 00000057510

520 ₽ Узнать оптовую цену В наличии
Амортизатор 01 пер "Белмаг" (масл) \ АКЦИЯ

Артикул: 9495

Код товара: 00000052826

546 ₽ Узнать оптовую цену Отсутствует
Амортизатор 01 пер "СААЗ" (ФИР УП) (20)

Артикул: 2101-2905402-06

Код товара: 00000028664

701 ₽ Узнать оптовую цену В наличии
Амортизатор 01 пер "СААЗ" (ФИР УП) (газ)

Артикул: 2101-2905004-10

Код товара: 00000028665

749 ₽ Узнать оптовую цену В наличии
Амортизатор 01 пер "САН-Д" (масл)

Артикул: 2101-2905402

Код товара: 00001979165

441 ₽ Узнать оптовую цену Отсутствует
Амортизатор 01 пер "Скопин-НИКОН" (24) (АКЦИЯ)

Артикул: 2101-2905004-02

Код товара: 00000068254

448 ₽ Узнать оптовую цену В наличии
Амортизатор 01 пер "Фенокс" масл (12)

Артикул: А11 001 С3

Код товара: 00000028666

662 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 зад "Hofer" (масл)

Артикул: HF505109

Код товара: 00000058727

567 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 зад "Riginal" (масл)

Артикул: 2121-2915402

Код товара: 00000057517

586 ₽ Узнать оптовую цену В наличии
Амортизатор 2121 зад "Белмаг" (масл)

Артикул: 0068

Код товара: 00000059246

636 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 зад "СААЗ" (ФИР УП) (20)

Артикул: 2121-2915402-03

Код товара: 00000028672

725 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 зад "СААЗ" (ФИР УП) (газ)

Артикул: 2121-2915006-10

Код товара: 00000028673

843 ₽ Узнать оптовую цену В наличии
Амортизатор 2121 зад "САН-Д"

Артикул: 2121-2915402-03

Код товара: 00000080226

441 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 зад "Скопин-НИКОН" (20) (АКЦИЯ) ТОП

Артикул: 2121-2915006-03

Код товара: 00000068257

435 ₽ Узнать оптовую цену В наличии
Амортизатор 2121 зад "Фенокс" (масл) (12)

Артикул: А12 285 C3

Код товара: 00000028674

690 ₽ Узнать оптовую цену В наличии
Амортизатор 2121 пер "Hofer" (масл) (10)

Артикул: HF505107

Код товара: 00000058726

557 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 пер "HOLA" (газ)

Артикул: S413

Код товара: 073717

525 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 пер "Riginal" (масл)

Артикул: 2121-2905402

Код товара: 00000057518

536 ₽ Узнать оптовую цену В наличии
Амортизатор 2121 пер "Белмаг" (масл)

Артикул: 0067

Код товара: 00000059245

636 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 пер "СААЗ" (ФИР УП) (28)

Артикул: 2121-2905402-03

Код товара: 00000028678

724 ₽ Узнать оптовую цену В наличии
Амортизатор 2121 пер "СААЗ" (ФИР УП) (газ)

Артикул: 2121-2905004-10

Код товара: 00000028679

843 ₽ Узнать оптовую цену В наличии
Амортизатор 2121 пер "САН-Д"

Артикул: 2121-2905002-03

Код товара: 00000080227

441 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2121 пер "Скопин-НИКОН" (24) (АКЦИЯ)

Артикул: 2121-2905004-03

Код товара: 00000068258

448 ₽ Узнать оптовую цену В наличии
Амортизатор 2121 пер "Фенокс" масл ( 12 )

Артикул: А11 059 С3

Код товара: 00000028680

676 ₽ Узнать оптовую цену Отсутствует
Амортизатор 21214 зад "Белмаг" (масл) в сб с с/бл

Артикул: 0126

Код товара: 00000064101

872 ₽ Узнать оптовую цену В наличии
Амортизатор 21214 зад "СААЗ" (ФИР УП) в сб с с/бл

Артикул: 21214-2915402

Код товара: 00000049886

1 050 ₽ Узнать оптовую цену В наличии
Амортизатор 21214 пер "Белмаг" (масл) в сб с с/бл

Артикул: 0125

Код товара: 00000065002

856 ₽ Узнать оптовую цену Отсутствует
Амортизатор 21214 пер "СААЗ" (ФИР УП) в сб с с/бл

Артикул: 21214-2905402

Код товара: 00000049887

993 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "Hofer" (масл) (10)

Артикул: HF505113

Код товара: 00000059086

793 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "Riginal" (масл)

Артикул: 2123-2915402

Код товара: 00001992003

732 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "Белмаг" (масл)

Артикул: 0087

Код товара: 00000059247

898 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "ОАТ" (ФИР УП) (масл)

Артикул: 45.2915402

Код товара: 00001978019

872 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "Ремофф" (масл) (АКЦИЯ)

Артикул: 2123--2915004-01

Код товара: 00000077510

473 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2123 зад "СААЗ" (ФИР УП) (газ)

Артикул: 45-2915402-10

Код товара: 00000062974

1 143 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "СААЗ" (ФИР УП) (масл) (21) ТОП

Артикул: 2123-2915402-03

Код товара: 00000028682

1 083 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "САН-Д" масл

Артикул: 2123-2915402

Код товара: 00001979168

594 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "Скопин-НИКОН" (масл) (20) (АКЦИЯ) ТОП

Артикул: 2123-2915004

Код товара: 00000068415

523 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 зад "Фенокс" масл

Артикул: А12287

Код товара: 00000057168

1 066 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2123 пер "Hofer" (масл) (10)

Артикул: HF505111

Код товара: 00000059085

793 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2123 пер "Riginal" (масл)

Код товара: 00001992004

630 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 пер "Белмаг" (масл)

Артикул: 0086

Код товара: 00000059248

825 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2123 пер "ОАТ" (ФИР УП) (масл)

Артикул: 2123-2905004-03

Код товара: 00001978018

867 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 пер "Ремофф" (масл) (АКЦИЯ)

Артикул: 2123--2905004-01

546 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2123 пер "СААЗ" (ФИР УП) (газ)

Артикул: 45000-2905402-10

Код товара: 00000062975

1 100 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 пер "СААЗ" (ФИР УП) (масл) (28) ТОП

Артикул: 2123-2905402-03

Код товара: 00000028683

1 083 ₽ Узнать оптовую цену В наличии
Амортизатор 2123 пер "САН-Д" масл

Артикул: 2123-2915004

Код товара: 00001979169

594 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2123 пер "Скопин-НИКОН" (масл) (24) (АКЦИЯ)

Код товара: 00001978462

536 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2123 пер "Фенокс" газ АКЦИЯ

Артикул: A21097

Код товара: 00000080574

714 ₽ Узнать оптовую цену Отсутствует
Амортизатор 2123 пер "Фенокс" масл АКЦИЯ

Артикул: А11005С3

Код товара: 00000072864

788 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 08, 2123, 2126 "AT" (1 шт)

Артикул: AT 2108-6308015

Код товара: 00001978093

376 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 08, 2123, 2126 "Autoram" (1 шт) (50)

Артикул: 2108-8231010

Код товара: 00001981724

252 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 08, 2123, 2126 "Hofer"

Артикул: HF522202

Код товара: 00000058745

321 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 08, 2123, 2126 "KRAFT" АКЦИЯ

Артикул: KT 003552

Код товара: 00001985834

336 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 08, 2123, 2126 "SURAI" (1 ШТ)

Артикул: 01102/2108-8231010

Код товара: 00001981372

263 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 08, 2123, 2126 "СААЗ" (ФИР УП) (1 ШТ)

Артикул: 21080-6308010-00

Код товара: 00000028685

427 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 08, 2123, 2126 "САН-Д"

Артикул: 2108-6308015

Код товара: 00001979216

231 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 1118 "Hofer" \12\

Артикул: HF522205

Код товара: 00000059091

326 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 1118 "СААЗ" \ (ФИР УП) (1015) (16см)

Код товара: 00000028687

548 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 1118 "САЗ" (1 ШТ)

Артикул: 1118-8231015

Код товара: 00000071093

263 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 1118 "САН-Д" (уп)

Артикул: 1118-8231010

Код товара: 00001979214

305 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 1118 "Фенокс" (1 шт)

Артикул: А901007 С3

Код товара: 00000076756

378 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 1119 "Hofer"

Артикул: HF522206

Код товара: 00000059092

378 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 1119 "SURAI" (1 ШТ) (50)

Артикул: 1119-8231015

Код товара: 00001995475

263 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 1119 "СААЗ" (ФИР УП) (1015) (1 шт)

Артикул: 1119-8231010

Код товара: 00000028688

600 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 1119 "САЗ" (1 ШТ)

Артикул: 1119-8231011

Код товара: 00000071094

263 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 1119 "САН-Д" (уп)

Артикул: 1119-8231010

Код товара: 00001979215

305 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 1119 "Фенокс" \1 шт\

Артикул: А901003 С3

Код товара: 00000076757

399 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2111 "Hofer" (1 ШТ)

Артикул: HF522203

Код товара: 00000059089

368 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2111 "SURAI" (1 ШТ) (50)

Артикул: 2111-8231011

Код товара: 00001995477

263 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 2111 "СААЗ" (1015-10) (ФИР УП) (1 шт)

Артикул: 2111-8231010

Код товара: 00000028689

634 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2111 "САЗ" (1 ШТ) "ВМ"

Артикул: 2111-8231011

Код товара: 00000064531

263 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2111 "САН-Д" (уп)

Артикул: 2111-8231010

Код товара: 00001979217

231 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2111 "Фенокс" \1 шт\

Артикул: A901004C3

Код товара: 00000071339

420 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2112, 1117 "Hofer"

Артикул: HF522204

Код товара: 00000059090

342 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2112, 1117 "KRAFT" АКЦИЯ

Артикул: KT 003554

Код товара: 00001985835

378 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 2112, 1117 "SURAI" (1 ШТ)

Артикул: 01104/2112-8231010

Код товара: 00001981373

263 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 2112, 1117 "СААЗ" (ФИР УП) (1 шт)

Артикул: 21120-8231010

Код товара: 00000028691

590 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2112, 1117 "САН-Д"

Артикул: 2112-8231015

Код товара: 00001979218

284 ₽ Узнать оптовую цену Отсутствует
Амортизатор зад дв 2112, 1117 "Фенокс" (1 шт)

Артикул: 901005

Код товара: 00000055479

407 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2121, 04 "Hofer" (кап 2110)

Артикул: HF522201

Код товара: 00000059088

315 ₽ Узнать оптовую цену В наличии
Амортизатор зад дв 2121, 04 "KRAFT" (кап 2110) \12\

Артикул: KT 003555

Код товара: 00001985836

399 ₽ Узнать оптовую цену В наличии

Эффективность гиполипидемической лекарственной терапии для пациентов с диабетом и недиабетом: метаанализ рандомизированных контролируемых исследований

Задача: Оценить клиническую пользу лечения гиполипидемическими препаратами у пациентов с сахарным диабетом и без него для первичной и вторичной профилактики.

Дизайн: Систематический обзор и метаанализ.

Источники данных: Cochrane, Medline, Embase и списки литературы по апрель 2004 г.

Выбор исследования: Рандомизированные плацебо-контролируемые двойные слепые испытания с последующим наблюдением не менее трех лет, в которых оценивали лечение гиполипидемическими препаратами у пациентов с сахарным диабетом и без него.

Извлечение данных: Два независимых рецензента извлекли данные. Первичным исходом были серьезные коронарные события, определяемые как смерть от ишемической болезни сердца, нефатальный инфаркт миокарда или процедуры реваскуляризации миокарда.

Результаты: Было включено двенадцать исследований.Было обнаружено, что медикаментозное лечение для снижения уровня липидов было не менее эффективным у пациентов с диабетом, чем у пациентов без диабета. При первичной профилактике снижение риска серьезных коронарных событий составило 21% (95% доверительный интервал от 11% до 30%; P <0,0001) у пациентов с диабетом и 23% (от 12% до 33%; P = 0,0003) у пациентов без диабета. пациенты. При вторичной профилактике соответствующее снижение риска составило 21% (от 10% до 31%; P = 0,0005) и 23% (от 19% до 26%; P <или = 0,00001). Однако при вторичной профилактике разница в абсолютном риске была в три раза выше.Когда результаты были скорректированы с учетом исходного риска, пациенты с диабетом получили больше преимуществ как при первичной, так и вторичной профилактике. Липиды крови были снижены в одинаковой степени в обеих группах.

Выводы: Доказательства того, что лечение гиполипидемическими препаратами (особенно статинами) значительно снижает риск сердечно-сосудистых заболеваний у пациентов с диабетом и недиабетом, убедительны и позволяют предположить, что пациенты с диабетом получают больше преимуществ как при первичной, так и при вторичной профилактике.В будущих исследованиях следует определить порог лечения этих пациентов и желаемые целевые концентрации липидов, особенно для первичной профилактики.

Ваз Н. М. (2011) Специфика иммунологических наблюдений. Конструктивистские фонды 6 (3): 334–342

Том 6 · Номер 3 · Страницы 334–342

Специфика иммунологических наблюдений

Нельсон Монтейро Ваз

Авторизация скачать полный текст в PDF

> Цитирование > Похожие > Ссылки > Добавить комментарий

Абстрактные

Контекст: иммунитет включает когнитивные концепции: считается, что организм специально распознает чужеродные материалы и развивает память об этих встречах.Считается, что вакцины работают, улучшая эту иммунологическую память. Лимфоциты являются ключевыми клетками, а специфические антитела - ключевыми молекулами в иммунном распознавании. Антитела - это белки крови, называемые «иммуноглобулинами». Спонтанно образованные иммуноглобулины рассматриваются как «естественные» антитела к компонентам питания и комменсальным бактериям. Иммунное познание используется просто как дидактическая метафора. Проблема: проистекают ли когнитивные аспекты иммунологии из деятельности клеток и молекул, или они приписываются иммунологу, действующему в качестве человека-наблюдателя? (1) Огромное количество иммуноглобулинов может связываться с одним и тем же антигеном с разной энергией связывания.Именно иммунолог определяет границу между теми, которые являются специфическими (и заявленными антителами), и теми, которые не являются таковыми. Специфические антитела служат функциональными метками, наклеенными на естественные иммуноглобулины, как если бы они распознавали элементы. Является ли этот «арбитраж» истинным когнитивным событием, приписываемым иммуноглобулинам и лимфоцитам? (2) Между прогрессом экспериментальной иммунологии и ее воплощением в клинические результаты существует серьезный тупик. Правильное понимание иммунологической активности требует более широкого взгляда на биологию организма, а также на вмешательство людей-наблюдателей в определение экспериментальных реалий, таких как специфичность иммунного распознавания.Биология познания и языка Матураны предлагает один из таких подходов. Метод: использование биологии познания и языковых концепций Матураны для описания иммунологической активности. Результаты: Предлагается совершенно новое понимание иммунологической активности. Последствия: предлагается серьезное изменение способа зрения, которое в конечном итоге может помочь перевести эти знания в клинические результаты. Кроме того, иммунная система также может стать подходящей моделью для когнитивного анализа.

Ключевые слова: иммунология, антитела, иммуноглобулин, специфичность, наблюдатель, реальность

Цитата

ВАЗ Н.М. (2011) Специфика иммунологических наблюдений. Основы конструктивизма 6 (3): 334–342. http://constructivist.info/6/3/334

Экспорт данных цитирования статьи: Простой текст · BibTex · EndNote · Справочный менеджер (RIS)

Похожие статьи

Список литературы

Беринг Э. фон, Китасато С. (1890) Механизм иммунитета животных к дифтерии и столбняку. В: Брок Э. Т. (ред.) Вехи в микробиологии. Американское общество микробиологов, Вашингтон: 138–140.▸︎ Google︎ Scholar Бернабе Р. Р., Коутиньо А., Казенаве П.-А. И Форни Л. (1981) Подавление повторяющегося идиотипа приводит к глубоким изменениям всего компартмента В-клеток. Слушания Национальной академии наук США 78: 6416–6421. ▸︎ Google︎ Scholar Биллингем Р. Э., Брент Л. и Медавар П. Б. (1953) Активно приобретенная толерантность к чужеродным клеткам. Природа 172: 603–606. ▸︎ Google︎ Scholar Бос Н. А., Беннер Р., Востманн Б. С. и Плезантс Дж. Р. (1986) «Предпосылки» Ig-секретирующих клеток у беременных стерильных мышей, получавших химически определенную ультрафильтрованную диету.Журнал репродуктивной иммунологии 9: 237–246. ▸︎ Google︎ Scholar Бернет Ф. М. (1957) Модификация теории продуцирования антител Джерна с использованием концепции клональной селекции. Австралийский научный журнал 20: 67–69. ▸︎ Google︎ Scholar Бернет Ф. М. (1959) Теория клонального отбора приобретенного иммунитета. Издательство Кембриджского университета, Кембридж. ▸︎ Google︎ Scholar Кэдвелл К., Патель К. К., Мэлони Н. С., Лю Т.-К., Нг А. С. Й., Сторер К. Э., Хед Р. Д., Ксавьер Р. Дж., Стаппенбек Т. С. и Вирджин Х.W. (2010) Взаимодействие вируса и гена восприимчивости определяет фенотипы гена болезни Крона Atg16L1 в кишечнике. Ячейка 141: 1135–1145. ▸︎ Google︎ Scholar Карвалью К. Р., Лензи Х. Л., Корреа-Оливейра Р. и Ваз Н. М. (2002) Косвенные эффекты пероральной толерантности к овальбумину мешают иммунным ответам, запускаемым яйцами Schistosoma mansoni. Бразильский журнал медико-биологических исследований 35: 1195–1199. ▸︎ Google︎ Scholar Черняк Л. и Таубер А. И. (1991) Диалектическое Я: Вклад иммунологии.В: Таубер А. Э. (ред.) Организм и истоки личности. Издательство Кембриджского университета, Нью-Йорк: 109–156. ▸︎ Google︎ Scholar Кон М., Митчисон А. В., Пол В. Э., Сильверштейн А. М., Талмейдж Д. В. и Вейгерт М. (2007) Размышления о теории клонального отбора. Nature Reviews Immunology 7: 823–830. ▸︎ Google︎ Scholar Коутиньо А. (2000). Отбор зародышевой линии обеспечивает аутореактивность эмбриона и позитивное различение самоопосредованных супраклональных механизмов. Семинары по иммунологии 12: 205–213; обсуждение 257–344.▸︎ Google︎ Scholar Коутиньо А. (2002) Иммунология на перепутье: поскольку десятилетия исследований привели к небольшому количеству клинических применений, пора подумать о новых исследовательских стратегиях, чтобы понять работу иммунной системы. EMBO Report 3: 1008–1011. ▸︎ Google︎ Scholar Коутиньо А., Форни Л., Холмберг Д., Иварс Ф. и Ваз Н. (1984) С антиген-центрированной, клональной точки зрения иммунных ответов на ориентированную на организм сетевую перспективу автономной активности в самореферентной иммунной системе.Immunological Reviews 79: 151–168. ▸︎ Google︎ Scholar Дэвис Дж. М. и О’Хехир Р. Э. (2004) Использование гена VH в ответах на иммуноглобулин Е у пациентов с сезонным ринитом, страдающих аллергией на пыльцу трав, является олигоклональным и определяется антигенами. Клиническая и экспериментальная аллергия 34: 429–436. ▸︎ Google︎ Scholar Эрлих П. (1900) Об иммунитете с особым упором на клеточную жизнь. Труды Королевского общества (Лондон) 66: 424–448. ▸︎ Google︎ Scholar Эйхманн К. (2008) Сетевой коллектив - Взлет и падение научной парадигмы.Биркхойзер, Берлин. ▸︎ Google︎ Scholar 2005) Повышенная реактивность поликлональных иммуноглобулинов по отношению к человеческим и бактериальным белкам связана с клинической защитой от инфекции Plasmodium человека. Журнал о малярии 4: 5–11. ▸︎ Google︎ Scholar Finger E., Brodeur P. H., Hernandez H. J. & Stadecker M. J. (2005) Расширение CD4 T-клеток, экспрессирующих сильно ограниченную структуру TCR, специфичную для одного эпитопа паразита, коррелирует с высокой патологией при шистосомозе мышей. Европейский журнал иммунологии 35: 2659–2669.▸︎ Google︎ Scholar Форни Л., Коутиньо А., Колер Г. и Джерн Н. К. (1980) Антитела IgM индуцируют выработку антител той же специфичности. Труды Национальной академии наук США 77: 1125–1128. ▸︎ Google︎ Scholar Haury M., Grandien A., Sundblad A., Coutinho A. & Nóbrega A. (1994) Глобальный анализ репертуаров антител. 1. Метод иммуноблоттинга для количественного скрининга большого количества реактивностей. Скандинавский журнал иммунологии 39: 79–87. ▸︎ Google︎ Scholar Хаури М., Sundblad A., Grandien A., Barreau C., Coutinho A. & Nóbrega A. (1997) Репертуар сывороточных IgM у нормальных мышей в значительной степени не зависит от внешнего антигенного контакта. Европейский журнал иммунологии 27: 1557–1563. ▸︎ Google︎ Scholar Huetz F., Sciard-Larsson E. L., Pereira P., Portnoi D. & Coutinho (1988) Т-клеточная зависимость «естественной» аутореактивной активации В-клеток в селезенке нормальных мышей. Европейский журнал иммунологии 18: 1615–22. ▸︎ Google︎ Scholar Джерн Н. К. (1951) Исследование алчности.Патолология Microbiology Scandinavica 87 (Приложение 1): 1–183. ▸︎ Google︎ Scholar Джерн Н. К. (1955) Теория образования антител естественным отбором. Труды Национальной академии наук США 41: 849–857. ▸︎ Google︎ Scholar Джерн Н. К. (1967) В ожидании конца. Симпозиумы Колд-Спринг-Харбора по количественной биологии 32: 591–603. ▸︎ Google︎ Scholar Джерн Н. К. (1974) К сетевой теории иммунной системы. Annales d’Immunologie 125C: 373–392. ▸︎ Google︎ Scholar Лакруа-Десмаз С., Маутон Л., Кавери С. В., Казачкин М. Д. и Векслер М. Э. (1999) Стабильность репертуаров природных самореактивных антител во время старения. Журнал клинической иммунологии 19: 26–34. ▸︎ Google︎ Scholar Ландштейнер К. (1901) Агглютинативные свойства нормальной крови человека. Wiener Klinische Wochenschrift 14: 424–448. ▸︎ Google︎ Scholar Мади А., Кенетт Д.Ю., Брансбург-Забари С., Мерб И.Ю., Кинтана Ф.Дж., Таубер А.И., Коэн И.Р. и Бен-Джейкоб Э. (2011) Анализ сетевой теории данных о реактивности антитело-антиген: деревья иммунитета при рождении и в зрелом возрасте .PLoS ONE 6, e17445. ▸︎ Google︎ Scholar Мартинес К.-А., Маркос М.А.Р., Перейра П., Маркес К., Торибио М., Казенаве П.-А. И Коутиньо А. (1987) Превращение (Ir-ген) лиц с низким уровнем ответа в лиц с высоким уровнем ответа путем манипуляции антителами развивающейся иммунной системы. Слушания Национальной академии наук США 84: 3812–3816. ▸︎ Google︎ Scholar Матурана Х. Р. (1970) Биология познания. Отчет лаборатории биологического компьютера 9, Департамент электротехники, Иллинойский университет, Урбана, штат Иллинойс.Перепечатано в: Матурана Х. Р. и Варела Ф. Дж. (1980) Аутопоэзис и познание. Reidel, Dordrecht: 1–58. ▸︎ Google︎ Scholar Матурана Х. Р. (1978) Биология языка: Эпистемология реальности. В: Миллер Г. А. и Леннеберг Э. (ред.) Психология и биология языка и мышления. Academic Press, Нью-Йорк: 27–64. ▸︎ Google︎ Scholar Матурана Х. Р. (1987) Все сказано наблюдателем. В: Томпсон В. И. (ред.) Гайя: способ познания. Политические последствия новой биологии. Линдисфарн Пресс, Нью-Йорк: 11–36.▸︎ Google︎ Scholar Матурана Х. Р. (2002) Автопоэзис, структурная связь и познание: история этих и других понятий в биологии познания. Кибернетика и знания человека 9: 5–34. ▸︎ Google︎ Scholar Матурана Х. Р. (2005) Происхождение и сохранение самосознания: Размышления по четырем вопросам Хайнца фон Ферстера. В: Риглер А. (ред.) Хайнца фон Ферстера - в память. Kybernetes: Международный журнал систем и кибернетики 34 (1-2): 54–88. ▸︎ Google︎ Scholar Мацингер П.(1994) Терпимость, опасность и расширенная семья. Ежегодный обзор иммунологии 12: 991–1045. ▸︎ Google︎ Scholar Медавар П. Б. (1944) Поведение и судьба кожных аутотрансплантатов и кожных гомотрансплантатов у кроликов. Анатомический журнал 78: 176–199. ▸︎ Google︎ Scholar Мподози Дж. (2011) Основы биологии. В: Vaz N. M., Mpodozis J. M., Botelho J. F. и Ramos G. C. (ред.) Onde está o organismo? Derivas e outras histórias na Biologia e na Imunologia. Editora UFSC, Флорианополис С.С. Бразилия: 25–44.▸︎ Google︎ Scholar Нобрега А., Хаури М., Грандиен А., Маланчере Э., Сундблад А. и Коутиньо А. (1993) Глобальный анализ репертуаров антител. II. Доказательства специфичности, самовыбора и иммунологического «гомункула» антител в нормальной сыворотке. Европейский журнал иммунологии 23: 2851–2859. ▸︎ Google︎ Scholar Парнес О. (2004) От перехвата к инкорпорации: вырождение и беспорядочное признание как предвестники смены парадигмы в иммунологии. Молекулярная иммунология 40: 985–991. ▸︎ Google︎ Scholar Подольский С.Х. и Таубер А. И. (1997) Поколение разнообразия: теория клонального отбора и рост молекулярной иммунологии. Издательство Гарвардского университета, Кембридж. ▸︎ Google︎ Scholar Пру Дж. (2008) Некоторые различия между теорией познания и конструктивизма Матураны и Варелы. Соучастие: Международный журнал сложности и образования 5: 11–26. ▸︎ Google︎ Scholar Кинтана Ф. Дж., Фарез М. Ф., Вильетта В., Иглесиас А. Х., Мербл Ю., Искьердо Г., Лукас М., Бассо А. С., Хури С. Дж., Луккинетти К.Ф., Коэн И. Р. и Вайнер Х. В. (2008) Микроматрицы антигенов идентифицируют уникальные сигнатуры сывороточных аутоантител при клинических и патологических подтипах рассеянного склероза. Труды Национальной академии наук США 105 (48): 18889–18894. ▸︎ Google︎ Scholar Кинтана Ф. Дж., Мербл Ю., Сахар Э., Хагедорн П. Х., Домани Э. и Коэн И. Р. (2006) Технология антиген-чипов для доступа к глобальной информации о состоянии организма. Волчанка 15: 428–430. ▸︎ Google︎ Scholar Рамос Г. К. (2011) Inflamação como um fenômeno do desenvolvimento animal.В: Vaz N. M., Mpodozis J. M., Botelho J. F. и Ramos G. C. (ред.) Onde está o organismo? Derivas e outras histórias na Biologia e na Imunologia. Editora UFSC, Флорианополис С.С. Бразилия: 125–142. ▸︎ Google︎ Scholar Ramos G.C. (2011) Предварительная пероральная обработка сердечными антигенами изменяет иммунологическую активность после инфаркта и улучшает восстановление сердца у крыс. Аутоиммунитет (представлен). ▸︎ Google︎ Scholar Шопенгауэр А. (1969) Мир как воля и представление. Том 2. Перевод Э. Ф. Дж. Пейна.Дувр, Нью-Йорк. Оригинальное издание на немецком языке под названием Schopenhauer A. (1819) Die Welt als Wille und Vorstellung. Ф. А. Брокгауз, Лейпциг. ▸︎ Google︎ Scholar Содерквист Т. (2003) Наука как автобиография. Беспокойная жизнь Нильса Йерна. Издательство Йельского университета, Нью-Йорк. ▸︎ Google︎ Scholar Talmage D. W. (1959) Иммунологическая специфичность, уникальные комбинации выбранных природных глобулинов обеспечивают альтернативу классической концепции. Наука 129: 1643–1648. ▸︎ Google︎ Scholar Талмейдж Д. В. (1995) Истоки теорий клеточного отбора для образования антител.В: Галлахер Р. Б., Гилдер Дж., Носсал Г. Дж. В. и Сальваторе Г. (ред.) Иммунология: создание современной науки. Academic Press, Сан-Диего: 23–38. ▸︎ Google︎ Scholar Таубер А. И. (1991) Диалектическое Я: Вклад иммунологии. В: Таубер А. Э. (ред.) Организм и истоки личности. Kluwer, Dordrecht: 109–156. ▸︎ Google︎ Scholar Таубер А. И. (1997) Исторические и философские взгляды на иммунное познание, Журнал истории биологии 30: 419–440. ▸︎ Google︎ Scholar Таубер А.I. (1998) Концептуальные сдвиги в иммунологии: комментарии к «двусторонней парадигме». В: К. Шаффнер Ф. и Старзл Т. Э. (ред.) Изменения парадигмы в трансплантации органов. Теоретическая медицина и биоэтика 19: 457–473. ▸︎ Google︎ Scholar Таубер А. И. (2010) Рассказ о двух иммунологиях. В: Гриньолио А. (ред.) Иммунология сегодня. Три исторических перспективы под тремя теоретическими горизонтами. Bononia University Press, Болонья: 15–34. ▸︎ Google︎ Scholar Васконселлос Р., Нобрега А., Хаури М., Виале А.C. & Coutinho A. (1998) Генетический контроль репертуаров природных антител: I. Бета-локусы IgH, MHC и TCR. Европейский журнал иммунологии 28: 1104–1115. ▸︎ Google︎ Scholar Ваз Н. М., Мартинес К.-А. И Коутиньо А. (1984) Уникальность и границы идиотипического «я». В: Koehler H., Cazenave P.-A. И Урбейн Дж. (Ред.) Идиотипия в биологии и медицине. Academic Press, Нью-Йорк: 44–58. ▸︎ Google︎ Scholar Ваз Н., Фариа А. М., Менезес Дж. С., Вердолин Б. А., Сильва Нето А. Ф. и Карвалью К.Р. (2003) Консервативная физиология иммунной системы. Бразильский журнал медико-биологических исследований 36: 13–22. ▸︎ Google︎ Scholar Вердолин Б. А., Фикер С. М., Фариа А. М. С., Ваз Н. М. и Карвалью С. Р. (2001) Стабилизация сывороточных ответов антител, вызванных начальным контактом слизистой оболочки с антигеном, независимо от индукции пероральной толерантности. Бразильский журнал медико-биологических исследований 34: 211–219. ▸︎ Google︎ Scholar Вухерпфенниг К. В., Аллен П. М., Селада Ф., Коэн И.Р., Де Бур Р.Дж., Кристофер Гарсия К., Гольдштейн Б., Гринспен Р., Хафлер Д., Ходжкин П., Хусеби Э.Б., Кракауэр Д.К., Немазим Д., Перельсон А.С., Пинилла К., Стронг Р.К. и Серкарц Э. (2007) Полиспецифичность распознавания рецепторов T.-клеток и B.-клеток. Семинары по иммунологии 19: 216–224. ▸︎ Google︎ Scholar

Комментарии: 0

Чтобы быть в курсе комментариев к этой публикации и оставлять комментарии, пожалуйста, сначала авторизуйтесь .

материалов | Бесплатный полнотекстовый | Модификация поверхности полимерных субстратов для биомедицинских приложений

1.Введение

Биоматериалы можно определить как материалы, которые вступают в контакт с биологической средой, будь то in vitro или in vivo, независимо от их происхождения. Биоматериалы могут быть металлами, керамикой, полимерами; они могут быть полностью или частично синтетическими или даже полностью биологическими. Способ их взаимодействия с биологической средой сложен и зависит от физико-химических свойств их поверхности [1]. Следовательно, чтобы придать биоматериалу свойства, подходящие для конкретного применения, необходимо модифицировать ту часть, которая контактирует с окружающей средой, - его поверхность.Свойства поверхности, такие как шероховатость, морфология, заряд, химический состав, поверхностная энергия и смачиваемость, влияют на взаимодействие биоматериала с биологическими соединениями [2]. Эти поверхностные свойства могут быть изменены различными методами, которые включают, помимо прочего, плазменную [3] или лазерную обработку [4], ионную имплантацию [5] и прививку наночастиц [6]. Каждый метод предлагает уникальный способ модуляции поверхности со своими достоинствами и недостатками, которые подробно рассматриваются в этой рукописи.Биосовместимость материала определяется как его способность вызывать соответствующий ответ в конкретной ситуации [7]. Поскольку этот «подходящий ответ» определяется ситуацией, в которой используется биосовместимый материал, он может варьироваться от адгезии и пролиферации клеток на материалах, используемых для имплантации, до полного запрета роста и коагуляции клеток на материалах, которые используются в кровотоке. Первым взаимодействием между биологической системой и биосовместимым материалом является адсорбция различных белков из биологических жидкостей системы на поверхность материала [8].Адсорбция белков на поверхности полимера зависит от его химического состава, а также от его морфологии и поверхностного натяжения [9]. Например, сильно гидрофильная поверхность не адсорбирует белки из крови, в то время как сильно гидрофобная поверхность предпочтительно связывает альбумин из-за его высокой концентрации в крови и благоприятного коэффициента диффузии. В целом, чем более гидрофильна поверхность и чем меньше полярных групп на ней, тем меньше адсорбция белков на ней.Для адгезии клеток необходимо изменить поверхностное натяжение путем введения новых функциональных групп, что приведет к соответствующей гидрофильности [10]. Необходимо, чтобы среди этих вновь введенных функциональных групп были представлены амино- и карбоксильные группы, поскольку они используются для связывания белков с поверхностью полимера. Прививка поверхности полимера факторами роста также способствует адгезии и пролиферации клеток [11]. Как упоминалось выше, биоматериалы не ограничиваются определенной группой материалов, и выбор исходного субстрата, который будет использоваться для последующей обработки поверхности, полностью зависит от ожидаемое применение конечного продукта.Каждый тип основного материала имеет свои преимущества и недостатки. Например, металлы демонстрируют превосходные механические свойства и поэтому часто используются в качестве заменителей костей или суставов [12]. Однако из-за их большого коэффициента расширения необходимо заменить их керамикой или каким-либо другим материалом в тех случаях, когда увеличение объема с повышением температуры может оказаться проблематичным [13]. Приложения, в которых желательна возможная деградация имплантированного материала, например, в стентах или швах, могут потребовать использования биоразлагаемых материалов, таких как определенные биоразлагаемые полимеры из природных источников [14].Существует множество биомедицинских применений для различных биоматериалов, и одной из наиболее широко используемых групп материалов являются полимерные субстраты. Полимеры происходят из природных или синтетических источников и могут быть относительно легко преобразованы в структуры, варьирующиеся от простых пленок до различных сложных форм. Они обладают широким спектром физико-химических свойств из-за большого разнообразия их химического состава, что делает их интересными кандидатами для биомедицинских приложений. Их использование ограничено их механическими свойствами, такими как предел прочности на разрыв и модуль Юнга, которые не соответствуют требованиям по сравнению с другими материалами, популярными в медицине, такими как металлы или керамические композиты.С другой стороны, полимеры очень гибкие и способны выдерживать большие деформации из-за большой степени свободы в перемещении отдельных полимерных цепей. Полимеры представляют собой полукристаллические материалы, и степень кристалличности влияет на их поведение при напряжении и деформации, которое может варьироваться от хрупкого до высокоэластичного [15]. Благодаря своей универсальности полимеры широко используются как в научных, так и в промышленных приложениях. Различные полимерные подложки обладают широким спектром физико-химических свойств, которые могут быть дополнительно изменены различными методами обработки поверхности для достижения свойств, подходящих для каждого отдельного применения.Методы обработки поверхности могут варьироваться от крупномасштабных, таких как химическая модификация или обработка УФ-лампой, изменяющих свойства нескольких квадратных метров поверхности за раз [16], до точных, затрагивающих всего квадратные сантиметры и меняющих всего несколько атомных слоев. подложки, например, при лазерной обработке [17]. Любая модификация поверхности приведет к изменению химического состава и морфологии поверхности, что, в свою очередь, более или менее заметно повлияет на оптические, механические, трибологические, адгезионные, электрические и различные другие свойства модифицированной подложки.Такие изменения должны происходить только на небольшой глубине от поверхности, в то время как основная масса модифицированного полимера и, следовательно, его свойства должны оставаться неизменными [18]. Хотя полимеры являются многообещающими материалами для множества биомедицинских приложений, они редко используются в их первозданный вид. Полимеры в их первозданном состоянии обычно биологически инертны, и поэтому требуется некоторая обработка поверхности, чтобы превратить их в более совершенные материалы, которые вызывают специфический отклик в различных биологических молекулах, с которыми они вступают в контакт.Модуляция свойств поверхности полимерных субстратов, таких как морфология и шероховатость, а также физико-химический состав, необходима для достижения желаемого взаимодействия между полимером и биологическим агентом. Соответствующая модификация поверхности может изменить морфологию поверхности полимера, приводя к появлению различных наноразмерных структур, которые служат в качестве якорных точек для определенных белков клеточной мембраны, тем самым улучшая адгезию клетки к обработанной поверхности [19]. к подложке - это двухэтапный процесс [20].Сначала клетка прилипает к поверхности благодаря нековалентным взаимодействиям (ван-дер-ваальсовым, водородным связям, электростатическим, полярным и ионным взаимодействиям) между конкретными молекулами в клеточной мембране и полярными группами на поверхности субстрата. Второй этап - это адгезия молекул, таких как фибронектин, витронектин, коллаген и ламинин, из внеклеточного матрикса, контролируемого рецепторами. Клетки прикрепляются через рецепторы интегрина, расположенные в цитоплазматической мембране, к определенным последовательностям аминокислот [21,22].Наиболее распространенная последовательность аминокислот, к которой прикрепляется клетка, - это триплет Arg-Gly-Asp [21]. Из-за сложного механизма клеточной адгезии и пролиферации взаимодействие клетки с полимером зависит от всех физико-химических и морфологических свойств поверхности полимера, как упоминалось ранее, что дает нам возможность модулировать поверхность соответствующим образом для обеспечения цитосовместимости. улучшение.

2. Лазерная обработка

Лазерное облучение твердых подложек при определенных условиях может привести к образованию так называемых лазерно-индуцированных периодических структур поверхности (LIPSS) [23].Эти периодические поверхностные структуры бывают разных форм и форм, и их можно разделить на две подгруппы в зависимости от отношения их периода к длине волны лазерного излучения. Те, которые имеют период, сравнимый с длиной волны падающего лазерного луча, называются LIPSS с низкой пространственной частотой, а те, период которых намного меньше длины волны лазерного луча, называются LIPSS с высокой пространственной частотой. Первые чаще всего наблюдаются на полимерных подложках, а вторые чаще образуются на обработанных лазером полупроводниках и металлах [24].Низкоинтенсивные LIPSS на полимерных фольгах обычно ориентированы вдоль главной оси поляризации лазерного луча [25]. Для их образования необходимо хорошее поглощение полимерной подложкой в ​​области длин волн лазерного излучения. По этой причине LIPSS в основном наблюдались на полимерах с сильно поглощающими группами, такими как ароматические кольца и системы сопряженных связей. Точный механизм образования ряби до сих пор остается предметом споров, однако широко принятая теория состоит в том, что ключом к процессу формирования ряби является интерференция между первичным (падающим) лучом и вторичным (перпендикулярно отраженным) лучом, что вызывает локальное накопление энергии, в результате чего некристаллическая фаза полимерной подложки временно нагревается выше температуры стеклования, а кристаллическая фаза плавится, что позволяет материалу течь из высокотемпературных областей в более низкотемпературные, таким образом создание периодического рисунка на поверхности полимера [24,26].Диапазон плотности энергии, в котором может быть сформирован периодический узор, отличается от полимера к полимеру и, кроме того, зависит от условий лазерной обработки. В общем, кажется, что чем больше поглощение полимера в желаемом диапазоне длин волн, тем шире диапазон флюенса, индуцирующего LIPSS. Например, при использовании эксимерного УФ-лазера LIPSS формируются в относительно узком диапазоне примерно 8–11 мДж / см 2 на полистироле (PS) [27], а на полиэтиленнафталате (PEN) они образуются в гораздо более широкий диапазон 6–12 мДж / см 2 [28].Поскольку PS имеет одно бензольное кольцо в своем мономерном звене, а PEN имеет два, мы можем предположить, что более высокое поглощение УФ-излучения PEN, по сравнению с PS, отвечает за увеличенный диапазон плотности энергии для образования LIPSS. Есть несколько типов LIPSS, которые могут образовываться на полимерах, и, безусловно, наиболее распространенными из них являются рябь. На некоторых полимерах наблюдаются и другие структуры. Например, на PS, при определенных условиях обработки, образованию ряби предшествует формирование глобулярных структур, которые образуются при значениях плотности энергии лазерного излучения, недостаточных для образования полностью развитой ряби, в которую они в конечном итоге сливаются при увеличении плотности энергии. в диапазоне, вызывающем пульсации [29].Размеры этих волн обычно зависят как от характеристик полимерной подложки, так и от условий лазерной обработки. В то время как высота ряби остается относительно постоянной во всем диапазоне плотности энергии, в котором однородный волновой узор развивается на данном полимере независимо от условий обработки, период (ширина) ряби увеличивается с увеличением угла падения лазерного луча. , согласно уравнению (1) где Λ - период пульсации в нанометрах, n - модифицированный показатель преломления, λ - длина волны, а α - угол падения лазерного излучения [24].Хотя это уравнение с постоянным n хорошо согласуется с измерениями размеров пульсации, полученными на некоторых полимерах, таких как полиэтилентерефталат (ПЭТ) [30], на других полимерах, таких как PEN и PS, сам модифицированный показатель преломления также должен быть функция угла падения лазерного луча для выполнения уравнения. Зависимость модифицированного показателя преломления от угла падения проистекает из того факта, что показатель является материальным свойством полимера, и, таким образом, изменения в структуре полимера, вызванные лазерной обработкой, обязательно должны изменить модифицированный показатель преломления как хорошо.Лазерная обработка полимерных подложек плотностью энергии значительно ниже порога абляции увеличивает адгезию клеток к модифицированной поверхности из-за изменений химического состава поверхности. Химические связи, разорванные лазерным излучением, приводят к присутствию на поверхности высокореактивных радикалов, которые быстро вступают в реакцию с окружающей атмосферой. Это приводит к насыщению кислородом поверхности и образованию новых функциональных групп, которые ранее не присутствовали в исходном полимере, таких как кислородсодержащие группы, такие как карбоксил и гидроксил, и, в меньшей степени, азотсодержащие группы, такие как аминогруппа. (Рисунок 1) [31].Поверхностная энергия полимерной подложки также изменяется при лазерной обработке. Такие изменения свойств, вызванные воздействием лазера, приводят к усилению адгезии и пролиферации клеток млекопитающих [32]. На PS, например, плотность клеток на модифицированных поверхностях увеличивается с продолжительностью лазерной обработки до определенной точки, где пик плотности примерно в 1,9 раза больше, чем на нетронутой подложке, достигается через 60 с при флюенс 12,5 мДж / см 2 [33].Дальнейшее увеличение продолжительности обработки приводит к уменьшению количества прикрепившихся клеток, что указывает на то, что чрезмерное количество новых функциональных групп, введенных на поверхность, является контрпродуктивным для клеточной адгезии и пролиферации. Увеличение плотности энергии выше порога абляции приводит к потере облучаемого материала. Процесс абляции может использоваться, наряду с химической модификацией поверхности, для создания бороздок, по которым клетки выравниваются во время адгезии [34,35]. Поверхность вдоль канавок становится функционализированной кислородными группами, и ее шероховатость увеличивается [36], что приводит к повышенной адгезии клеток в модифицированной области.Хотя нетронутые поверхностные неполярные полимеры, такие как полистирол, являются сильно гидрофобными с высокими значениями краевого угла смачивания, лазерная обработка вызывает сдвиг в сторону гидрофильности, заметно снижая угол смачивания, независимо от условий обработки, таких как угол падения или лазерный луч. флюенс. Ослабленное полное отражение - измерения инфракрасной спектроскопии с преобразованием Фурье (НПВО - FTIR) показывают, что лазерная обработка вводит значительное количество карбонильных групп в поверхность за счет как ароматических, так и алифатических групп C-H и C-C.В ПС содержание кислорода увеличилось с 1,9 ат. % (что предполагает, что поверхность слегка окислена даже в первоначальном состоянии, поскольку кислород изначально не присутствует в мономере стирола) до 21,8 ат. % [37]. На полимерах, которые изначально содержат атомы кислорода, таких как полиэтиленнафталат, увеличение было менее резким, но все же очень значительным [28]. Несмотря на то, что тесты на пролиферацию клеток с использованием клеточной линии клеток эмбриональной почки человека HEK-293 показали, что не было заметной разницы между чистый и обработанный лазером PS через 1 день после посева, через 4 и особенно через 8 дней стало очевидно, что модификация поверхности лазером оказывает положительное влияние на пролиферацию клеток из-за изменений в химии и морфологии поверхности, так как количество Количество клеток на обработанных лазером пленках из полистирола увеличивается в два или три раза по сравнению с количеством клеток на чистом полистироле, что дает результаты, сравнимые с обычно используемым стандартом TCPS [37].Еще одно интересное применение лазерной обработки полимерных субстратов для биомедицинских применений, о котором кратко упоминалось ранее, заключается в том, что клетки проявляют преимущественную ориентацию вдоль неоднородностей морфологии поверхности [38,39]. Например, в то время как клетки эмбриональной почки человека HEK-293, пролиферирующие на первичном PS, случайным образом распределяются по гладкой поверхности, клетки, пролиферирующие на некоторых обработанных лазером образцах того же полимера, демонстрируют систематическую ориентацию, параллельную ориентации ряби.Решающим фактором, выравниваются ли ячейки по ряби или нет, оказывается период ряби, ширина [40]. Клетки, прикрепленные к образцам, облученным перпендикулярно (ширина волны 200 нм), демонстрируют случайную ориентацию, аналогичную той, которая была прикреплена к исходному образцу, в то время как клетки, прикрепленные к образцам, облученным под углом 15 ° (270 нм), демонстрируют предпочтительную ориентацию примерно в 50% случаев, а клетки, пролиферирующие на образцах, облученных под углами 30 ° и 45 ° (340 нм и 430 нм, соответственно), полностью выровнены вдоль главной оси ряби [37].На степень преимущественной ориентации клеток вдоль поверхностных структур влияет не только размер этих структур, но и тип засеянных клеток [41,42]. Клеточная линия яичников китайского хомячка, CHO-K1, например, демонстрируя результаты, аналогичные клеточной линии HEK-293, по-видимому, предпочитает структуры большего размера. Миобласты человека также демонстрируют выравнивание, подобное клеточной линии CHO-K1, а эффект предпочтения более крупных поверхностных структур еще более выражен в скелетных миобластах крыс, которые демонстрируют преимущественное выравнивание только на образцах с рябью с большими периодами (430 нм) [37].При определенных условиях обработки наблюдались различные типы поверхностных образований, такие как глобулярные наноструктуры, например, на PES (рис. 2) [43], которые также могут применяться для управления клетками.

3. Ионная имплантация

Другим способом изменения биосовместимости полимерной поверхности является ионная имплантация, которая может увеличить как адгезию, так и последующую пролиферацию клеток [44]. ионы высоких энергий (например, в диапазоне от 10 13 до 10 15 см −2 ) разделяются магнитным полем и ускоряются в электрическом поле перед имплантацией в поверхность подложки, и их энергия быстро увеличивается рассеивается и вызывает изменения в структуре полимера за счет разрушения макромолекулярных цепей.Разрыв полимерных цепей приводит к увеличению концентрации высокореактивных радикалов в поверхностном слое. Это приводит не только к повышенной реакционной способности поверхности, но также к сшиванию разорванных макромолекулярных цепей, образованию двойных связей и высвобождению газообразных продуктов разложения [45,46]. Структуры, сформированные в полимере при ионной имплантации, аналогичны структурам, образованным при пиролизе, но они обнаруживаются только в поверхностных слоях полимера, а не во всем объеме материала [47].Для биомедицинских применений используются ионы благородных газов, которые считаются биологически инертными, или ионы таких элементов, как кислород или азот, которые обычно можно найти в биомолекулах [48,49]. Для конкретных применений ионы цитотоксических элементов, таких как серебро, можно использовать для создания поверхности, на которой не происходит клеточной адгезии [50]. На процесс ионной имплантации влияют несколько переменных. На глубину проникновения влияют как вес, так и энергия ионов.Для биомедицинских применений часто используются низкие энергии в диапазоне десятков кэВ, поскольку предполагается, что клетки взаимодействуют только с самыми верхними слоями материала, и поэтому достаточно небольшой глубины проникновения [51]. Для адгезии и пролиферации клеток млекопитающих необходимо хорошее закрепление на субстрате. Для этого необходимы соответствующие физико-химические свойства и морфология поверхности. Чистые полимеры обычно гидрофобны или имеют отрицательный заряд, что затрудняет адгезию клеток.Ионная имплантация позволяет изменять поверхностные свойства полимера, включая его биосовместимость. Повышение биосовместимости можно объяснить, среди прочего, повышенной полярностью модифицированной поверхности и наличием богатых кислородом групп, а также увеличением ее шероховатости, что приводит к увеличению площади поверхности [52] . Адгезия клеток к субстрату опосредуется связыванием за счет электростатических сил, а также через специфические молекулы внеклеточного матрикса [53].Диффузия ионов в поверхностные слои модифицированного полимера увеличивает проводимость и биосовместимость. Более низкие дозы ионов приводят к образованию кислородсодержащих групп и увеличению свободного объема, что способствует дальнейшему проникновению в модифицированный слой, создавая слегка пористую структуру. Напротив, более высокие дозы приводят к более заметному сшиванию и образованию двух- и трехмерных структур, сопровождающихся уменьшением свободного объема, в который труднее проникать последующими ионами [54].Следовательно, можно модулировать глубину проникновения не только энергией имплантированных ионов, но и их плотностью. Другой важный аспект - размер отдельных атомов. Например, небольшие атомы, такие как фтор, не включаются в модифицированный слой и выделяются с другими газообразными побочными продуктами, в то время как более крупные атомы, такие как йод, хорошо включаются и остаются в полимерной подложке [55]. Имплантированные атомы связаны либо с высокоактивными свободнорадикальными центрами, либо с вновь образованными двойными связями [56].При равной энергии более легкие ионы имеют больший диапазон средних расстояний проникновения в полимер по сравнению с более тяжелыми ионами, которые имплантируются ближе к поверхности модифицированной подложки. Поскольку ионы всегда проникают глубже, чем самый верхний поверхностный слой, независимо от веса и энергии, можно с уверенностью предположить, что адгезия клеток зависит не только от самой поверхности полимера, но и от физико-химических свойств определенного диапазона глубин. поверхностные слои [57]. Ионная имплантация также существенно меняет морфологию обрабатываемой поверхности.Например, ионы аргона и кислорода увеличивают шероховатость поверхности пропорционально дозе и приводят к образованию волокнистой структуры. Однако в некоторых случаях ранее упомянутое сшивание и уменьшение свободного объема, вызванное более высокими дозами ионов, может привести к уменьшению шероховатости поверхности по сравнению с эффектом более низких доз ионов [58]. Когда речь идет о клеточной адгезии, решающее значение имеет морфология поверхности. Известно, что клетки выстраиваются вдоль бороздок, образованных во время обработки поверхности [59].Увеличение шероховатости поверхности полимеров, которые в своем первоначальном состоянии очень гладкие, часто приводит к улучшенной адгезии клеток. В целом эффект шероховатости и морфологии поверхности зависит как от полимерного субстрата, так и от типа засеянных клеток [60]. Увеличение электропроводности, вызванное ионной имплантацией, объясняется не только разрывом связей цепей макромолекул имплантированными ионами и последующим образованием свободных радикалов и сопряженных двойных связей, но и присутствием проводящих примесей в обработанных поверхностных слоях.Карбонизация и графитизация, которые также происходят во время ионной имплантации при достаточной энергии и дозах ионов, также положительно влияют на электропроводность поверхности [61]. Взаимодействие между поверхностным зарядом и зарядом засеянных клеток является важным фактором для правильной адгезии. Определенные участки с отрицательным зарядом на клеточной мембране используются как в процессах распознавания, так и в процессах адгезии, когда клетка входит в контакт с чужой поверхностью. Будет ли способствовать адгезии слегка отрицательный или слегка положительный заряд, зависит от типа засеянных клеток.Кроме того, слегка заряженные группы влияют на сорбцию определенных белков клеточной мембраны, ответственных за правильную адгезию [62]. Изменения смачиваемости полимерного субстрата, вызванные ионной имплантацией, под влиянием модуляции химического состава, шероховатости и морфологии поверхностные слои также оказывают заметное влияние на его биосовместимость [63]. В то время как ионная имплантация обычно увеличивает полярность поверхности неполярных полимеров из-за образования богатых кислородом групп на активных центрах, создаваемых разрывом макромолекулярной цепи, имплантация полимеров с полярными поверхностями имеет противоположный эффект.Это связано с деградацией полярных групп, которые уже присутствовали в таких подложках [19]. Поскольку соответствующая доза ионов снижает подвижность макромолекулярных цепей из-за увеличения сшивки, переориентация полярных групп в основной объем материала, наблюдаемая на обработанных плазмой образцах, которая вызывает повышение гидрофобности по мере старения полимерных подложек, подавляется [ 64]. Это полезно для создания устойчивых изменений полярности на поверхности высокогидрофобных полимеров, необходимых для соответствующего взаимодействия таких неполярных субстратов с различными типами клеток млекопитающих.В то время как полярность полимерного субстрата является важным фактором его взаимодействия с засеянными клетками, конкретные значения смачиваемости поверхности зависят от типа засеянных клеток. Когда речь идет об увеличении биосовместимости, вызванном изменениями химического состава поверхности Из обработанных образцов ему приписывают такие биогенные элементы, как C, N и O, а также их функциональные группы [65]. Например, наблюдалось, что присутствие аминокислот прямо пропорционально адгезии и разрастанию засеянных клеток.Положительно заряженные аминогруппы принимают участие во взаимодействиях с отрицательно заряженными участками связывания клеточной мембраны. Богатые кислородом группы также способствуют адгезии клеток к модифицированной поверхности [66]. Некоторые клетки млекопитающих также могут положительно реагировать на поверхность, на которой присутствуют как гидрофобные, так и гидрофильные микроскопические домены, поскольку домены с различной смачиваемостью и химической структурой предпочтительны для разных белков. Такая доменная структура может быть достигнута путем селективной ионной имплантации через контактную маску и приводит к организованной мозаике адсорбированных белков [67].

4. Плазменная обработка

Во время плазменной обработки может происходить заметная потеря материала. Толщина экспонированного или обработанного слоя зависит как от полимерной основы, так и от мощности и продолжительности плазменной обработки. Химическая и физическая структура полимера играет ключевую роль при травлении. Полимеры с более высокой степенью кристалличности демонстрируют более низкую скорость травления, чем более аморфные, из-за большей структурной целостности кристаллической фазы.Молекулярный вес и ориентация полимерных цепей также играют роль в скорости травления [68]. Скорость травления и изменения морфологии, вызванные обработкой плазмой, естественно зависят не только от продолжительности обработки, но и от используемой мощности [69]. Измерения угла контакта с водой, проведенные сразу после обработки плазмой, обычно показывают значительное уменьшение краевой угол смачивания водой независимо от продолжительности обработки в зависимости от типа полимера [70]. Таким образом, поверхность, которая изначально была сильно гидрофобной, приобретает гидрофильные свойства, которые, однако, сохраняются лишь частично по мере старения образца.Медленное изменение влияния плазменной обработки на полярность поверхности вызвано переориентацией богатых кислородом полярных групп, образовавшихся на аблированной поверхности во время плазменной обработки, в объем материала, что приводит к изменению поверхности. химии за счет уменьшения содержания кислорода [71]. Смачиваемость полимерных подложек, подвергнутых плазменной обработке, зависит от мощности плазмы, напряжения смещения, типа газа и газового потока. Количество кислорода, адсорбированного модифицированной поверхностью полимера во время и после плазменной обработки, также зависит от подвижности макромолекулярных цепей, которая также влияет как на сшивание на поверхности, так и на кристалличность всего полимера [72].Например, UHMWPE, полимер с высокомобильными макромолекулярными цепями [73], показывает большее увеличение содержания атомарного кислорода после плазменной обработки, чем PEN, полимер, цепи которого намного более жесткие из-за присутствия нафталиновой группы [74] . Тема смачивания вызвала огромный интерес как с фундаментальной, так и с прикладной точки зрения. Исследования смачиваемости обычно включают измерение углов смачивания в качестве первичных данных, которые показывают степень смачивания при взаимодействии твердого вещества и жидкости.Рассмотрим каплю жидкости, покоящуюся на плоской горизонтальной твердой поверхности, контактный угол определяется как угол, образованный пересечением границы раздела жидкость-твердое тело и границы раздела жидкость-пар (геометрически полученный путем нанесения касательной линии от точки контакта вдоль граница раздела жидкость-пар в профиле капли). Малые углы смачивания (90 °) соответствуют низкой смачиваемости. Когда угол смачивания мал, жидкость растекается по поверхности, тогда как большой угол смачивания наблюдается, когда жидкость не растекается.Плазменная обработка также приводит к изменению шероховатости поверхности модифицированных полимеров. В то время как увеличение шероховатости некоторых полимеров может быть едва заметным (LDPE), для других увеличение гораздо более значительным (HDPE). На других полимерах плазменная обработка все же может привести к уменьшению шероховатости поверхности (UHMWPE) [73]. Различные степени изменения шероховатости поверхности, вызванные плазменной модификацией, связаны с вышеупомянутой скоростью абляции. Поскольку аморфная фаза аблируется с большей скоростью, чем кристаллическая, плазменная обработка приводит к появлению различных кристаллических структур после того, как абляция аморфной фазы происходит на поверхности полимерных подложек, где обе фазы присутствуют в некоторой степени одинаково, что приводит к увеличению шероховатость поверхности.С другой стороны, на полимерах, где преимущественно присутствует одна фаза, материал удаляется равномерно, что может снизить шероховатость поверхности [75]. Плазменная обработка также приводит к резкому изменению дзета-потенциала, который зависит от химического состава, полярности и заряда поверхности, а также от ее морфологии и, следовательно, от ее шероховатости. Полярные группы, введенные на поверхность при плазменной обработке, увеличивают дзета-потенциал модифицированных образцов [76]. В зависимости от химического состава полимера в его первоначальном состоянии значения неизмененной поверхности варьируются от сильной гидрофобности в случае неполярных полимеров до гидрофильности полярных.Увеличение дзета-потенциала зависит от продолжительности обработки - чем дольше обрабатываются образцы, тем больше увеличение [77]. Влияние используемой мощности на изменение дзета-потенциала гораздо менее значимо. Интересно, что, в отличие от гониометрических измерений, старение практически не влияет на дзета-потенциал, поскольку в некоторых конкретных случаях заряд остается стабильным даже через месяц после модификации [78]. Поскольку основные белки и клеточные мембраны имеют слегка отрицательный заряд в среде с физиологическим pH, индуцированный плазмой сдвиг в сторону положительного заряда на поверхности полимера облегчает адгезию клеток млекопитающих, на которые также могут влиять привитые группы на полимере. поверхность (рис. 3) [79].Тестирование биосовместимости различных обработанных плазмой полимерных субстратов с различными клеточными линиями демонстрирует необходимость модификации каждого субстрата определенным образом для получения соответствующего биологического ответа для желаемого применения. В случае ПЭ тесты адгезии клеток млекопитающих с использованием гладкомышечных клеток сосудов крысы (VSMC) и фибробластов мыши (L929) показали, что обработка плазмой приводит к значительному увеличению биосовместимости поверхности для всех трех модификаций полимера (LDPE, ПНД и СВМПЭ).Параметры плазменной обработки для оптимальной биосовместимости для этих клеточных линий зависят от субстрата. В то время как самое короткое время обработки, составляющее 120 с, приводит к максимальному увеличению количества прикрепившихся клеток как для LDPE, так и для HDPE, для UHMWPE более длительное время обработки, равное 240 с, дает наилучшие результаты. По сравнению со стандартом TCPS обработанные плазмой PE-субстраты показывают значительно большее количество прилипших клеток L929, в то время как клетки VSMC прилипают в гораздо большем количестве к стандартному тканевому полистиролу.Кроме того, тесты метаболического анализа показывают, что жизнеспособность клеточной линии L929 намного ниже на субстратах на основе PE по сравнению со стандартным TCPS. Это подчеркивает, что количество прикрепленных клеток не является достаточным для оценки цитосовместимости данного материала [73]. По сравнению с поведением клеточной линии VSMC на субстратах на основе PE, результаты PEN более обнадеживающие. Все модифицированные образцы показывают гораздо большее количество прикрепившихся клеток через 7 дней после посева по сравнению с TCPS.Жизнеспособность пролиферированных клеток очень высока на всех образцах, обработанных плазмой, и демонстрирует значения, сопоставимые с жизнеспособностью, измеренной по стандарту TCPS. Даже клетки, пролиферирующие на чистом PEN, демонстрируют аналогичную жизнеспособность, несмотря на их меньшее количество, что позволяет предположить, что PEN является материалом с хорошим потенциалом для биомедицинских применений, и даже быстрая плазменная обработка при низкой мощности значительно увеличивает привлекательность его поверхности для клеток млекопитающих [ 74]. Обработка аргоновой плазмой малой мощности (до 8 Вт) существенно влияет на морфологию клеток, что можно продемонстрировать, например, e.Например, на FEP, обработанном плазмой, по сравнению с нетронутой фольгой (рис. 4) [80]. Мощная плазма использовалась в качестве инструмента для придания шероховатости поверхности и изменения химического состава поверхности с целью улучшения биосовместимости. Более высокая мощность плазмы углубляла профиль поверхности, что было связано с повышенной шероховатостью. Было подтверждено, что и Ar, и плазма O 2 / Ar вызывали значительные изменения угла смачивания поверхности после процедуры старения фольги FEP. Пролиферация клеток эмбриональных фибробластных клеток мыши (NIH 3T3) была в несколько раз выше на обработанных плазмой PMP, если мы сравним результаты с исходными PMP.Скорость роста клеток на обработанных матрицах PMP напоминала скорость роста TCPS. Также был определен различный тип формы клеток на основе воздействия плазмы. Клетки на исходном PMP имели округлую форму, не были растянутыми и не имели типичных выступов актина (Рисунок 5) [81]. На жизнеспособность прилипших клеток сильно влияют гидрофильность, химические изменения и шероховатость поверхности субстрата. Это особенно верно в случае остеобластов, у которых высокая шероховатость поверхности положительно влияет на их метаболическую активность [82].Плазменная обработка может использоваться для изготовления супергидрофильных или супергидрофобных полимерных поверхностей посредством травления кислородной плазмой органических полимеров, таких как полиметилметакрилат (ПММА) [83] и полиэфирэфиркетон (PEEK) [84]. Плазменная модификация полимерных субстратов используется во многих потенциальных приложениях в биологии и биохимии. Модифицированные поверхности могут усиливать абсорбцию белка [85], вызывать супергидрофобные поверхности бумаги с помощью плазменного травления при атмосферном давлении [86], они могут применяться для иммобилизации биомолекул и экологически устойчивого супергидрофобного и суперолеофобного поведения [87,88] или в лабораторных условиях -а-чип приложений [89].Недавно сообщалось о биомедицинском применении полимеров на природной основе в сочетании с наночастицами биоактивного стекла [90], также было подтверждено влияние наночастиц биоактивного стекла, легированных серебром, на антибактериальный биоадгезивный слой для ортопедических применений [91]. Иммобилизация биомолекул на поверхностях может рассматриваться как первый шаг для создания большого количества разнообразных функциональных субстратов, которые включают микроматрицы, массивы клеток, микрофлюидики для диагностических целей, биосовместимые поверхности для медицинских применений, таких как имплантаты, и многое другое [92] .Плазменная обработка может применяться для начальной активации поверхности, которая дополнительно усиливает связывание различных молекул или более сложных соединений [93]. Биомолекула обычно считается «иммобилизованной» на твердом носителе, если она либо физически адсорбируется на носителе за счет сил Ван-дер-Ваальса, водородных связей или электростатических взаимодействий, либо ковалентно присоединена к активным поверхностным группам и не может быть удалена с носителя простым такие методы, как промывание буферами. Было показано, что интенсивная ионная бомбардировка во время процессов модификации плазмы и полимеризации эффективна для стимулирования прочного поверхностного прикрепления белковых молекул с увеличенным сроком службы по сравнению с белковыми слоями на необработанных и обработанных плазмой (без ионной бомбардировки) контроле.Долгосрочное сохранение биоактивности как в растворе, так и после лиофилизированного хранения, по-видимому, коррелирует с долгосрочным сохранением гидрофильного характера, наблюдаемого на обработанных ионами поверхностях [94]. Считается, что ковалентная иммобилизация поддерживает более высокую активность биомолекул, снижение неспецифической адсорбции и большую стабильность иммобилизованных биомолекул по сравнению с физической адсорбцией [95].

5. Прививка наночастиц.

Наноструктурированная поверхность может способствовать адгезии клеток, обеспечивая фокусные точки для прикрепления филоподий, тем самым имитируя важные части морфологии внеклеточного матрикса [96].Когда дело доходит до выбора материала для создания наночастиц, существует множество вариантов, каждый из которых имеет свои преимущества и недостатки. Среди самых популярных материалов - различные благородные металлы, каждый из которых обладает уникальными свойствами. Например, наночастицы серебра обладают антимикробными свойствами и поэтому часто используются на субстратах, где взаимодействие с биологической средой нежелательно [97], в то время как наночастицы золота редко вызывают аллергическую реакцию и считаются не цитотоксичными.Наночастицы золота, кроме того, обладают хорошими биосовместимыми свойствами и, таким образом, являются хорошим кандидатом для различных биомедицинских приложений в иммунологии, наномедицине и биотехнологии [98,99]. Наночастицы на основе углерода также представляют собой интересный вариант, поскольку существует несколько типов наноразмерных углеродных структур с многообещающими биомедицинскими применениями из-за их уникальных физико-химических свойств. Наиболее часто изучаются углеродные нанотрубки, алмазоподобный углерод и углеродные наноалмазы. Углеродные нанотрубки могут использоваться в качестве систем доставки лекарств или, благодаря своей очень высокой электропроводности, могут улучшить заживление поврежденных нервных волокон.Их хорошие механические свойства также делают их интересным кандидатом для создания полимерных композитов, используемых в качестве заменителей кости. Точно так же превосходные механические свойства алмаза, такого как углерод, делают его популярным в качестве покрытия для различных имплантатов [100,101,102,103]. В процессе создания наночастиц с целью прививки на поверхность полимеров для различных биомедицинских приложений существует множество переменных, которые необходимо контролировать, например форму, размер и его распределение.Одной из наиболее важных и трудных для контроля переменных является дисперсия наночастиц. Наночастицы обладают очень высокой поверхностной энергией, что делает их склонными к агломерации, и поэтому часто требуется подходящая среда для создания раствора наночастиц или дополнительная обработка поверхности [104]. Например, углеродные наночастицы могут быть функционализированы различными аминогруппами, которые улучшают их смачиваемость и облегчают приготовление водной суспензии за счет подавления их склонности к агломерации [105].Прививка полимерного субстрата часто представляет собой многоступенчатый процесс, в котором физико-химические свойства и морфология поверхности должны быть сначала изменены, чтобы гарантировать соответствующие взаимодействия и достаточные места связывания для привитых наночастиц или биомолекул [106]. Есть разные степени активации поверхности. Например, в случае ПЭТ-фольги с привитыми наночастицами благородных металлов (Pt и Pd) поверхность сначала обрабатывалась плазмой, чтобы создать достаточное количество мест связывания. Следовательно, активные центры, созданные плазменной обработкой, были заняты бифенил-4,4’-дитиолом (BPD), который используется в качестве связывающего агента для закрепления наночастиц Pt и Pd на полимерной подложке.Наконец, клетки млекопитающих были привиты к вновь созданной поверхности [107]. Разрыв макромолекулярных цепей, вызванный предварительной обработкой плазмой, приводит к образованию высокореактивных свободных радикалов на поверхности модифицированного полимера. Эти радикальные активные центры быстро атакуются молекулами кислорода из атмосферы, образуя различные кислородсодержащие группы и, таким образом, увеличивая полярность поверхности и уменьшая ее угол контакта с водой, то есть увеличивая ее смачиваемость. Затем изменения смачиваемости медленно возвращаются по мере старения образцов, и полярные группы на поверхности полимера переориентируются в объем материала [108].После достаточно длительного времени старения значения краевого угла могут даже превзойти исходные значения исходной подложки в случае ароматических полимеров, таких как ПЭТ [109] или ПЭН [74]. Степень увеличения краевого угла в процессе старения зависит не только от химической структуры полимерной подложки, но и от мощности плазменного разряда и продолжительности обработки [110]. В случае полиэтилена, который не содержит ароматических ядер в своей структуре, более короткая продолжительность обработки приводит к большему общему уменьшению краевого угла смачивания, при этом 50-секундная обработка показывает наименьший краевой угол смачивания из всех.С этого момента увеличение продолжительности обработки приводит к увеличению краевого угла смачивания, при этом образцы, обработанные в течение 200 с и более, в конечном итоге превышают краевой угол смачивания исходного полиэтилена. Как только предварительно обработанная плазмой поверхность привита BPD и / или наночастицами Au, краевой угол значительно уменьшается, и его зависимость от продолжительности исходной плазменной обработки становится менее резкой [111]. Потери материала, вызванные предварительной плазменной обработкой. может привести к появлению различных структур на аблированной поверхности из-за абляции кристаллической и аморфной фаз полимера с разной скоростью [112].В случае ПЭ [111], например, предварительная обработка приводит к образованию ламеллярных структур на аблированной поверхности, увеличивая ее шероховатость, тогда как на ПЭТ [113] глобулярные структуры наблюдались после плазменной модификации. Морфология активируемых плазмой полимерных подложек дополнительно изменяется за счет последующего закрепления связующих агентов и прививки наночастиц. Например, прививка обработанной плазмой поверхности PE с помощью BPD немного снижает шероховатость и сужает пластинчатые структуры, в то время как последующая прививка наночастиц Au приводит к образованию нанокластеров золота и увеличению шероховатости до уровней до связывания BPD [111] .Подобный эффект увеличения шероховатости также наблюдался на ПЭТ и ПЭВП, привитых функционализированными углеродными наночастицами [113], где наблюдалось положительное влияние углеродных наночастиц на пролиферацию клеток (рис. 6). Количество наночастиц, связанных с модифицированной поверхностью, не зависит от только на плазменной и химической предварительной обработке, но также на типе и материале привитых наночастиц. Наночастицы имеют совершенно разные предпочтения, когда дело доходит до химии и морфологии поверхности - например, более высокая концентрация серы на подложках, предварительно обработанных BPD, что предполагает большее количество пятен связывания для наночастиц, не обязательно означает увеличение их поверхности. концентрация.На ПЭТ наночастицы Pt показали предпочтение более длительному времени предварительной обработки в плазме, в то время как для наночастиц Pd все было наоборот [107]. Преимущественное связывание наночастиц благородных металлов с тиоловыми группами BPD, закрепленных на поверхности обработанного плазмой полимера, было подтверждено FTIR-анализом полос поглощения, соответствующих связи C-SH тиоловой группы, прикрепленной к поверхности, и CS. -Pd и CS-Pt связи соответствующих наночастиц связаны с другой, свободной тиоловой группой [107].Аналогичный результат был достигнут при использовании BPD для закрепления наночастиц на поверхности PE [111]. Предварительная плазменная обработка, а также окончательная прививка наночастиц благородных металлов также приводят к значительному изменению дзета-потенциала из-за изменения поверхностного заряда полимера, вызванного увеличением полярных групп в поверхностном слое [ 114]. Наночастицы Pt и Pd вызвали значительный сдвиг в сторону положительного заряда [107], в то время как наночастицы Au (Рисунок 7), с другой стороны, вызывают резкое уменьшение значений, значительно ниже значений исходной полимерной подложки, значительно увеличивая проводимость привитой поверхность, которая, как известно, улучшает биосовместимость [111].Как упоминалось ранее, различные наночастицы подходят для различных биомедицинских применений [115,116,117]. Кроме того, изменение свойств поверхности, таких как смачиваемость, шероховатость, заряд, проводимость и другие, вызванное предварительной обработкой плазмой и последующей прививкой наночастиц, которое по отдельности относилось бы к улучшению биосовместимости, может не иметь общего положительного эффекта конец. Взаимодействие самих наночастиц с биологической средой также существенно влияет на адгезию и пролиферацию клеток, и разные клетки проявляют разную степень сродства к разным наночастицам [118].Например, тесты на цитосовместимость, проведенные на поверхности ПЭТ с привитыми наночастицами с использованием клеточных линий фибробластов мышиных клеток (L929) и клеточных линий костной остеосаркомы человека (U-2 OS) с использованием TCPS в качестве стандарта, показывают, что функционализация ПЭТ наночастицами Pd фактически приводит к уменьшается намного ниже количества клеток, наблюдаемых на исходном ПЭТ, из-за цитотоксичности Pd, в то время как прививка с Pt увеличивает количество клеток, превышая даже количество, пролиферировавшее на TCPS. Однако клеточная линия U-2 OS на одном и том же субстрате ведет себя по-разному.Для этой линии клеток и Pt, и Pd цитотоксичны [119]. Напротив, тесты биосовместимости с использованием линии VSMC на PE с привитым Au показывают, что PE, функционализированный BPD-закрепленными наночастицами Au, обладает превосходными свойствами в отношении клеточной адгезии и пролиферации [111]. VSMC также демонстрируют хорошее сродство к поверхности, привитой углеродными наночастицами, особенно на ПЭТ. На HDPE с привитыми углеродными наночастицами количество пролиферирующих клеток немного ниже, чем на образце, обработанном исключительно плазмой, но все же намного выше, чем количество, наблюдаемое на чистом субстрате [113].С другой стороны, наночастицы серебра значительно усиливают как антибактериальные, так и цитотоксические свойства полимерного субстрата при прививании к его поверхности (рис. 8), что позволяет применять их в тех случаях, когда необходимо подавление адгезии клеток к биоматериалу [120].

Несмотря на то, что методы модификации плазмы, лазера или ионного пучка были хорошо известны уже несколько лет, в этой очень интересной и широкой области исследований можно найти много перспектив. Мы считаем, что по-прежнему существуют некоторые серьезные проблемы, в основном связанные с разработкой новых основных материалов (полимеров, металлов и др.), Которые могут быть подвергнуты дальнейшей обработке, а также с новыми методами обработки поверхности, основанными на различных источниках плазмы, лазера или ионного пучка в сочетание с различными процедурами прививки.Мы думаем, что также 2D и 3D-печать, например, полимерных материалов с уникальными свойствами, которые могли бы специфически реагировать, например, с длиной волны лазерного луча или которые включали бы определенные химические группы в полимерную цепь, имеют высокий потенциал. Синергия с новыми разработанными материалами в сочетании с усовершенствованными методами модификации поверхности и процедур трансплантации может дать новые материалы с высоким потенциалом, такие как замены тканей, замены органов, биосенсоры, антибактериальные материалы или материалы для конкретных применений.

Эффективность гиполипидемической лекарственной терапии для пациентов с диабетом и недиабетом: метаанализ рандомизированных контролируемых исследований

  • Программа совместного принятия информированных решений по профилактике инфаркта миокарда при диабете 2 типа: рандомизированное контролируемое исследование

  • Is сахарный диабет эквивалент ишемической болезни сердца?

  • Мониторинг использования гиполипидемических препаратов среди лиц с впервые диагностированным диабетом: общенациональное исследование на основе регистров

  • Осведомленность, лечение и контроль холестерина ЛПНП ниже среди U.S. Взрослые с недиагностированным диабетом в сравнении с диагностированным диабетом

  • Интенсивное снижение уровня глюкозы и профилактика сердечно-сосудистых заболеваний при диабете: согласование данных недавних клинических испытаний

  • Клинические предикторы развития бляшек, несмотря на очень низкие уровни липолопротеина

    99
  • Повторный скрининг липидов: каковы наилучшие меры и интервал?

  • Диабет и атеросклероз: играет ли роль гипергликемия?

  • CNTO736, новый агонист рецептора глюкагоноподобного пептида-1, снижает резистентность к инсулину и подавляет продукцию липопротеинов очень низкой плотности у мышей, питающихся высоким содержанием жира

  • Взаимосвязь абдоминальных висцеральных и подкожно-жировых липопротеинов Количество и размер больных сахарным диабетом 2 типа

  • Лучшие практики по снижению риска сердечно-сосудистых заболеваний при диабете

  • Эффекты статинов у пациентов с хроническим заболеванием почек: метаанализ и мета-регрессия рандомизированных контролируемых исследований

  • Должны ли мы быть более агрессивными в терапии сердечно-сосудистых факторов риска ?: Должны ли мы назначать статины и аспирин каждому пациенту с диабетом, или пришло время принимать полипиллы?

  • Следует ли прописывать статины и аспирин каждому диабетическому пациенту ?: Пришло ли время для полипиллы?

  • Активированный пролифератором пероксисом рецептор- {гамма} агонист Пиоглитазон увеличивает количество и функцию эндотелиальных клеток-предшественников у пациентов с ишемической болезнью сердца и нормальной толерантностью к глюкозе

  • Важная роль инсулино-подобного фактора роста 1 в области развития и функции сердца

  • Профилактика и раннее выявление сосудистых осложнений диабета

  • Из библиотеки

  • Статины для первичной профилактики диабета 2 типа

  • Агрессивное снижение липидов особенно полезно для диабетиков

  • Агрессивное снижение липидов особенно полезно при диабете

  • Липидепрепараты при диабете: реферат вводит в заблуждение

  • Липидопрепараты при диабете: снижение липидов имеет офтальмологические преимущества

  • Гиполипидемические препараты s при диабете: абсолютное снижение риска - вот что важно

  • Диабет и снижение липидов: где мы?

  • Анализ профиля экспрессии микроРНК путем секвенирования малых РНК у плодов с синдромом Дауна

    Введение

    Синдром Дауна (СД) вызывается возникновением три копии хромосомы 21 и связан с рядом вредные фенотипы, включая когнитивные нарушения, детство лейкемия и иммунные дефекты.Эти сложные и разнообразные фенотипы обычно считались результатом взаимодействия между генами 21 хромосомы человека (Hsa21) с другими дисомными генами (1). Недавняя биоинформатика аннотация показала, что Hsa21 содержит> 500 генов, включая 14 генов, кодирующих микроРНК (т.е. hsa-miR-99a, let-7c, miR-125b, miR-155, miR-802, miR-3197, miR-3648, miR-3687, miR-4327, miR-4759, miR-4760, miR-3118-5, miR-3156-3 и miR-548x) (2). Более того, в предыдущих исследованиях 5 из 14 микроРНК, происходящих из Hsa21 (т.е.е., hsa-miR-99a, let-7c, miR-125b-2, miR-155 и miR-802), как было доказано, коррелируют с сложные и вариабельные фенотипы DS и сверхэкспрессироваться в сердце, лобная кора и гиппокамп плодов DS (1,3–5). Однако изменения, связанные с экспрессией miRNA в масштабе всего генома плодов DS под влиянием трисомии 21 еще предстоит определенный. MiRNA потенциально может регулировать большое количество гены, кодирующие белок, в то время как целевой ген также может регулироваться множественные миРНК (6).Таким образом молекулярные механизмы регуляции лежащего в основе прогрессирования сложные и вариабельные фенотипы DS должны быть исследованы, чтобы идентифицировать паттерны экспрессии miRNA в масштабе всего генома.

    MicroRNAs (miRNAs) представляют собой класс эндогенных, 18–25 нуклеотиды (нт) длинные, одноцепочечные РНК, которые возникли как ключевые посттранскрипционные регуляторы экспрессии генов и играют ключевая роль в различных клеточных процессах, таких как пролиферация клеток, дифференциация, апоптоз, эмбриональное развитие и ткань дифференциация (2,7–9).miRNA транскрибируются из внутри- и межгенетических областей геном РНК-полимеразой II (10). После их обработки созревают miRNA собираются в рибонуклеопротеиновые комплексы, известные как miRNA-индуцированные комплексы сайленсинга (RISC). RISC впоследствии подавляет экспрессию генов за счет идеального комплементарного связывания мРНК деградация или несовершенное связывание в области 3'UTR для ингибирования перевод (11). Это ненормально было доказано, что экспрессия участвует в возникновении и развитие заболеваний (11–14).

    Методологии, основанные на гибридизации, такие как микроматрицы и анализы на основе ПЦР до сих пор использовались для идентифицировать и профилировать связь между производными Hsa21 miRNA и вариабельные фенотипы DS. Сетупати и др. (5) впервые использовали количественную ПЦР (кПЦР) для изучения miR-155, производного от Hsa21, в фибробластах из монозиготные близнецы, дискордантные по трисомии 21 (один близнец был без изменений, тогда как у другого была трисомия 21) и подтвержденная miR-155 была сверхэкспрессирована в фибробластах близнеца с DS.Этот результат может иметь отношение к наблюдаемому более низкому кровяному давлению в лица с DS. Впоследствии Kuhn et al (3) оценили профили экспрессии miRNA. образцов гиппокампа DS с помощью микрочипов и подтвердили, что пять микроРНК, происходящих из Hsa21, были сверхэкспрессированы в головном мозге DS. Более того, они подтвердили, что miR-155 и miR-802 связаны. с когнитивными нарушениями у людей с СД, регулируя ген метил-CpG-связывающего белка (MeCP2) (4,13).

    Кроме того, ряд исследований косвенно определено, что происходящие из Hsa21 miRNA могут частично вносить вклад в большинство наблюдаемых фенотипов DS.Например, hsa-miR-125b и miR-99a связаны с педиатрическим AML (не-DS) (15), 10 из 89 предсказанных мишеней miR-155 гены участвуют в гемопоэтических и миелопролиферативных нарушения (14) и hsa-miR-99a, let-7c и miR-125b могут действовать как опухолевые супрессоры, важная роль в снижении частоты солидных опухолей при СД частные лица (16–18). В качестве альтернативы предыдущие исследования (1,15–18) в основном сосредоточены на Hsa21-производных экспрессия miRNA в тканях субъектов DS человека, в то время как несколько исследований сосредоточились на определении профилей экспрессии miRNAs выделен из образцов крови человека.Таким образом, было бы клинически актуально для изучения механизмов регуляции ранних генов, связанных с нарушениями кроветворения и иммунными нарушениями при СД пациенты. Кроме того, легче получить образцы крови. по сравнению с образцами тканей.

    В настоящем исследовании, чтобы исследовать экспрессия, характерная для miRNA во время развития DS плода и определить, расположен ли другой ген miRNA на Hsa21 (в дополнение к подтвержденным 14 миРНК, происходящим из Hsa21), Технология высокопроизводительного секвенирования Illumina была использована для всесторонне охарактеризовать профили экспрессии miRNA в пуповинная кровь DS и контрольных плодов.По сравнению с предыдущим методы на основе гибридизации, методы высокопроизводительного секвенирования имеют существенные преимущества. Во-первых, они могут предоставить больше интегрированный вид транскриптома miRNAs и выявление скромных или даже малочисленные миРНК, которые предыдущие методы не могли обнаружить. Во-вторых, этот метод может успешно идентифицировать новые миРНК. посредством прямого наблюдения и проверки потенциала сворачивания фланкирующих геномных последовательностей (19). Использование секвенирования Illumina технологии, 395 известных miRNA и 181 новый кандидат miRNA были определены в этом исследовании.Более того, 149 известных miRNA были значительно дифференцированно экспрессировались, и были обнаружены две новые миРНК. расположен в «критической области DS» хромосомы 21 (chr21q22.2–22.3). Данные, полученные в этом исследовании, дают значительное понимание понимания выражения характеристика миРНК в DS мононуклеарной пуповинной крови плода клетки (CBMC). Дифференциально экспрессируемые miRNA могут быть связаны при нарушениях кроветворения и иммунных дефектах ДС плоды и новорожденные.

    Материалы и методы
    Клинические образцы и этика Выписка

    Всего шесть DS и шесть контрольных пуповинных тканей плода. образцы крови (18–22 нед. гестации) были взяты у Народная больница Шэньчжэня, Китай.Три ДС и три шнура управления образцы крови были объединены, чтобы сформировать объединенный DS и контрольный шнур. образцы крови, соответственно, для построения библиотеки малых РНК и Секвенирование Illumina. Остальные три DS и три контрольных образцы были использованы в качестве набора для проверки, чтобы подтвердить miRNA паттерны дифференциальной экспрессии с помощью КПЦР. Образцы пуповинной крови получены путем пункционной экстракции с помощью цветного Ультразвуковая допплерография во время дородового обследования женщин. пренатальная диагностика. Затем образцы были проверены белком. электрофорез для исключения загрязнения материнской крови клетки.Характеристики каждого корпуса приведены в Таблица I. Письменное информированное согласие для биологических исследований было получено от всех участников. Исследование было одобрено этическим комитетом Шэньчжэньского университета. Народная больница.

    Таблица I

    Характеристики для каждого случая.

    Таблица I

    Характеристики для каждого случая.

    +21 4,8268 37 902 902 902 902 902 902 6, XX 902 902 902 902 902
    ID матери Возраст (лет) Гестационный возраст (недель) Результат кариотип Белок электрофорез

    HBA (%) HBF (%)
    Пациент 1a 44 20 47, XX, + 21 5.5 94,5
    Пациент 2a 36 20 47, XX, + 21 6,7 93,3
    Пациент 3a 30 21 4,8 95,2
    Пациент 4 34 20 47, XX, + 21 6,2 93,8
    Пациент 5 22 47 5.7 94,3
    Пациент 6 32 19 47, XX, + 21 6,4 93,6
    Контроль 1a 46268 21 902 XX 95,2
    Контроль 2a 36 20 46, XY 6,4 93,6
    Контроль 3a 30 462,820 902,820 9022
    Контроль 4 34 18 46, XY 6,8 93,2
    Контроль 5 33 22 46, XX Контроль 6 32 21 46, XX 5,2 94,8

    CBMC были разделены Ficoll-Paque (Sigma, St. Луис, Миссури, США) центрифугированием в градиенте плотности в соответствии с инструкции производителя.Вкратце, 2 мл крови (с ЭДТА как антикоагулянт) наносили на 3 мл Ficoll-Hypaque (Sigma) и центрифугировали 25 мин при 1300 об / мин при комнатной температуре. Мононуклеарные клетки на границе раздела были аспирированы с помощью Пастера. пипетку, дважды промытую PBS центрифугированием 10 мин при 900 об / мин при комнатной температуре и растворяют в 1 мл TRIzol® реагент (Invitrogen, Карлсбад, Калифорния, США). Затем образцы были хранится при -80 ° C до дальнейшего использования.

    Выделение общей РНК и секвенирование

    Выделение тотальной РНК проводили с CBMC с использованием Реагент TRIzol (Invitrogen) по данным производителя. инструкции.Подготовка и секвенирование библиотеки малых РНК были выполнено с помощью технологии секвенирования Illumina (BGI-Shenzhen, Шэньчжэнь, Китай). Вкратце, популяция малых РНК (мРНК) была выделен путем отделения 10 мкг общей РНК денатурирующей электрофорез в полиакриламидном геле (PAGE) и удаление части геля соответствующего размера (15–30 нт) на основе на стандартные олигонуклеотидные маркеры. МРНК лигировали с 3 ' (5′-pUCGUAUGCCGUCUUCUGCUUGidT-3 ′) и 5 ​​′ (5'-GUUCAGAGUUCUACAGUCCGACGAUC-3 ') адаптеры с использованием РНК-лигазы Т4 и очищен на 15% трис-борат-ЭДТА (ТВЕ) мочевина в ПААГ.Модифицированный Затем мРНК подвергали обратной транскрипции с помощью RT-Primer малой РНК Illumina. (5'-CAAGCAG AAGACGCATACGA-3 '). КДНК использовали в качестве матрицы. для ПЦР-амплификации (15 циклов) с использованием праймера малой РНК Illumina набор (5'-CAAGCAGAAGACGGCATACGA-3 'и 5'-AATGATACGGCGACCACCGACAGGTTCAGAGTTCT ACAGTCCGA-3 '). Усиленный кДНК затем очищали с помощью 6% TBE PAGE и секвенировали на Illumina Hi-Seq 2000 по данным производителя инструкции.

    Фильтр чтения и аннотация малых РНК

    Два набора данных секвенирования мРНК, содержащие DS и контрольные CBMC были получены из ускоренного секвенирования Illumina сервисов и были отправлены в омнибус экспрессии генов NCBI (http: // www.ncbi.nlm.nih.gov/geo/) под серии инвентарный номер GSE39436. Показания низкого качества были отфильтрованы, чтобы исключить те, которые с наибольшей вероятностью представляют ошибки секвенирования и последовательности адаптеров 3 '/ 5' впоследствии были обрезаны для чистых полноразмерных чтений и отформатированы в неизбыточный формат FASTQ. Частоты каждого уникального маленького Считывания последовательности РНК рассчитывали как теги последовательности (количество чтения для каждой последовательности отражает ее относительную численность) и только последовательности малых РНК размером от 18 до 30 нуклеотидов были сохранены для последующий анализ.

    Уникальные чтения секвенирования, прошедшие фильтры, были сопоставлен с эталонным геномом человека с помощью протокола SOAP (версия 2.0) программа с не более чем двумя несовпадениями (20). Впоследствии уникальная последовательность считывания, сопоставленные с геномом человека, были сопоставлены с miRBase версии 17.0, Rfam 10.0 (http://rfam.sanger.ac.uk/), piRNABank (NCBI) и аннотация UCSC человеческого гена hg19 (http://genome.ucsc.edu/). Перекрывающаяся аннотация последовательности из этих данных были классифицированы как миРНК, тРНК, рРНК, мРНК, мяРНК, мяРНК, пиРНК или другие некодирующие РНК.В неаннотированные последовательности, которые не перекрываются ни с одной из этих аннотации, но могут кодироваться межгенными и интронными областями человеческого генома, служила источником потенциальных новых микроРНК (11).

    Нормализация расчета частей на миллион (TPM)

    Выполнен этап нормализации, поскольку общая количество чтений из разных экспериментов было неодинаковым и вариации числа прочтений отдельных миРНК, возможно, были за счет глубины секвенирования.Количество чтений из уникальной последовательности (представляющий miRNA) был разделен на общее количество клонов образца и умножили на 106. Общее количество клонов было сумма частот всех остаточных уникальных последовательностей после фильтрация.

    Анализ экспрессии известных miRNA и предсказание новых miRNAs

    Дифференциально экспрессируемые miRNA между двумя библиотеки были идентифицированы методом кратной замены, как описано в предыдущем исследовании (9). В статистическая значимость (P) была выведена на основе байесовского метод, который был разработан для анализа цифрового гена профили экспрессии и могут учитывать вариабельность выборки теги с низким счетчиком (21).Если не указано иное, уникальные последовательности с> 10 TPM в две библиотеки были проигнорированы, а наиболее часто наблюдаемые isomiR использовали в качестве диагностической последовательности для сравнения miRNA выражение между библиотеками. Считалось, что специфическая miRNA существенно дифференцированно регулируется, если P определяется этим метода было ≤0,001, и было как минимум 2-кратное изменение нормализованное количество последовательностей.

    Неаннотированные последовательности, которые можно выровнять с геном человека был рассмотрен для обнаружения нового кандидата миРНК.Вкратце, 100 нуклеотидов геномных последовательностей, фланкирующих каждая сторона неаннотированных последовательностей была извлечена. РНК вторичные конструкции со свободной энергией сворачивания менее или равные -18 ккал / моль (Mfe ≤-18 ккал / моль) были спрогнозированы с использованием RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi). В вторичные структуры были проанализированы с помощью MIREAP (настройка по умолчанию) (http://sourceforge.net/projects/mireap/), который является сложный инструмент, обычно используемый для идентификации новых miRNA из данные секвенирования с высокой пропускной способностью и широко использовались в связанных исследования (22,23).При этом сложенные выявленные конструкции были дополнительно протестированы общедоступным классификатор miRNA (miRDeep) для уменьшения количества ложных срабатываний (24). Кроме того, мРНК происходящие из одних и тех же предшественников, были сгруппированы в общую семью и самый многочисленный член был выбран как представитель семья.

    КПЦР

    кПЦР выполняли, как описано ранее (3), с небольшими изменениями. Вкратце, тотальную РНК выделяли из CBMC с использованием реагента TRIzol (Invitrogen). в соответствии с инструкциями производителя.РНК были обратными транскрибируется в кДНК с помощью праймеров RT типа стержень-петля (GenePharma, Шанхай, Китай), которые специфичны только для зрелой миРНК. видов, а затем количественно оценивается на Applied Biosystems 7500 в реальном времени. Система ПЦР (Applied Biosystems, Карлсбад, Калифорния, США) с использованием SYBR-Green Мастер-микс ПЦР (Toyobo, Осака, Япония). Реакция ПЦР была проводили при 95 ° C в течение 5 мин, затем инкубировали при 95 ° C в течение 15 минут. сек, 65 ° C в течение 15 секунд и 72 ° C в течение 32 секунд и повторяется в течение 40 секунд. циклы. Каждую ПЦР повторяли не менее трех раз.Относительная уровень экспрессии каждой miRNA был нормализован относительно RNU6B уровни экспрессии. Кратность изменения рассчитывалась согласно 2-ΔΔCT метод.

    Предсказание целей и генная онтология (GO) анализ

    Как описано ранее (9), целевые гены для каждого значимо дифференцированно регулируемая miRNA была предсказана miRecords (http://mirecords.biolead.org/), который объединяет предсказанные цели с помощью следующих инструментов прогнозирования мишеней miRNA: ДИАНА-microT, MicroInspector, miRanda, MirTarget2, miTarget, NBmiRTar, PicTar, PITA, RNA22, RNAhybrid и TargetScan / TargertScanS.Поскольку прогнозирование мишеней miRNA часто страдает от высокого уровня ложноположительных результатов, только целевые гены поддерживается как минимум 5 из 11 установленных целевых прогнозов учитывались программы, скомпилированные с помощью miRecords.

    Термины генной онтологии (GO) предсказанного целевые гены были аннотированы с помощью инструмента аннотации генов DAVID (http://david.abcc.ncifcrf.gov/summary.jsp). В виде описанный ранее (25), Программное обеспечение GeneMerge использовалось для идентификации значительное чрезмерное количество конкретных терминов GO.Условия GO и miRNA были сгруппированы с использованием иерархической кластеризации в R. Тепловая карта был создан в R с помощью функции тепловой карты (по умолчанию параметры).

    Результаты
    Секвенирование и аннотация мРНК

    Используя технологию секвенирования Illumina, всего 24 026 800 и 21 448 373 тегов необработанных последовательностей были сгенерированы в DS (P) и контрольная (N) группы соответственно. После удаления некачественное чтение и маскировка последовательностей адаптера, Было получено 21 770 279 (P) и 17 482 100 (N) тегов последовательностей. что соответствует 280 056 (P) и 232 814 (N) уникальным прочтениям.На рис.1 показано распределение длины малые РНК. Большинство малых РНК из двух библиотеки имели длину ~ 22 нт, что согласуется с типичный размер miRNA, генерируемых после активности Dicer. Этот открытие показало, что miRNA были последовательно обогащены из две библиотеки.

    Последовательности из 18-30 нуклеотидов были затем сопоставлены с человеческими геном с использованием протокола SOAP (версия 2.0) с максимум двумя несовпадениями. Всего 8 087 250 (P) и 12 536 630 (N) тегов последовательностей представлены 58 523 (P) и 73 833 (N) уникальных чтения. чтобы соответствовать геному человека.Теги последовательностей были аннотированы и классифицированы по различным категориям (миРНК, тРНК, рРНК, мРНК, sn / snoRNA, piRNA, другие некодирующие РНК и неаннотированные РНК) в соответствии с их перекрытием с общедоступным геномом аннотации (данные не показаны). Для миРНК 2208096 (P) и 6,369,123 (N) тегов последовательностей были аннотированы в (P) и (N), соответственно. Избыточные неаннотированные теги последовательностей служили источник новых miRNA.

    Известные паттерны экспрессии miRNA

    В этом исследовании было обнаружено всего 395 miRNA. из двух библиотек на основе miRBase 17.0. Чтобы определить дифференциально регулируемые miRNA в двух образцах, мы изначально нормализовал количество каждой микроРНК до TPM, как описано в разделах «Материалы и методы. Результаты показали, что разные миРНК проявляют значительно различаются уровни экспрессии от <1 до > 10000 т / мин (рис. 2). Несколько члены семейства let-7, miR-103a, miR-107, miR-15b, miR-16, miR-185 и miR-320a наблюдались как некоторые из высокоэкспрессированных миРНК. В то время как члены семейства let-7, let-7a, c, d, e, f и g представляли ~ 43.7% от общего количества miRNA в (N). Примечательно, что miRNA семейства let-7 были зарегистрированы как очень распространенные. miRNAs в различных тканях взрослого человека и имеют решающее значение в эмбриогенезе (26) и развитие мозга (27).

    На основе нормализованного числа считываний на выборку, 149 miRNA были идентифицированы как значительно дифференциально выражены с кратным изменением> 2,0 и P <0,001. Из 149 значимо дифференцированно экспрессировались миРНК, 143 миРНК были подавлена, а 6 miRNA активированы в группе DS (Таблица II).Кроме того, еще один 51 miRNA была специфически экспрессирована в группе N (данные не показано). Эти специфически обогащенные miRNA могут быть выбраны как кандидаты диагностических биомаркеров для DS плодов. Следует отметить, что результаты Этот эксперимент продемонстрировал, что 4 из 14 миРНК, происходящих из Hsa21, (hsa-miR-99a, let-7c, miR-125b-2 и miR-155) подавлялись в группа DS. Напротив, другие миРНК, происходящие из Hsa21, не были количественно определено в любой из двух библиотек с помощью секвенирования Illumina технология, которая может быть связана с отсутствием праймеров специфичны для этих микроРНК (3).

    Таблица II

    Шесть регулируемых и 14 подавленные miRNA, которые дифференциально экспрессировались в DS группа (кратное изменение> 2,0 и P <0,001).

    Таблица II

    Шесть регулируемых и 14 подавленные miRNA, которые дифференциально экспрессировались в DS группа (кратное изменение> 2,0 и P <0,001).

    hsa-miR-4732-5p 903 43

    905 902 904 272

    87
    Относительное количество

    miRNA-ID Контрольная группа DS группа Фолд-изменение P-value
    hsa-miR-90 19690 902.92 261,82 286,08 0
    hsa-miR-483-5p 4,75 55,95 11,78 7,56E-209
    21,85 241,01 11,03 0
    hsa-miR-320b 61,72 159,71 2,59 3 -486-5p 4357,89 11160,35 2.56 0
    hsa-miR-92b * 55,43 129,35 2,33 2,38E-128
    hsa-miR-125b-2 2,8 3.26E-33
    hsa-miR-99a 16.93 4.82 3.51 1.43E-32
    hsa-let-7c 4134.17
    hsa-miR-16 3215.80 752,20 4,28 0
    hsa-miR-22 103,02 17,13 6,01 1,27E-297
    17,73
    17,72

    7,84 0
    hsa-miR-98 20,19 1,88 10,72 3,14E-79
    hsa-miR-126
    hsa-miR-126 902 903 902 902 903 902 903 902 902 902 902 903 .43E-198
    hsa-miR-181a 880,39 24,53 35,89 0
    hsa-miR-181b 369,98 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 902 -miR-21 950,34 7,30 130,12 0
    hsa-miR-223 862.20 5,42 159,07 0 0 0 0 0,18 195,24 3,13E-212
    hsa-miR-155 26,31 0,00 # DIV / 0! 2.30E-162

    Для проверки результатов секвенирования Illumina исследованиях, мы выполнили количественную ПЦР со специфической ОТ. праймеры для изучения уровней экспрессии производных от Hsa21 зрелые миРНК и 6 случайным образом отобранных значительно дифференцированно экспрессированные miRNA, включая две miRNA с повышенной регуляцией (hsa-miR-196b и miR-92b *) и четыре miRNA с пониженной регуляцией (hsa-miR-16, miR-126, miR-21 и miR-223).Результаты показали, что четыре Зрелые миРНК, происходящие из Hsa21 (hsa-miR-99a, let-7c, miR-125b-2 и miR-155) подавлялись, и три зрелые миРНК, происходящие из Hsa21, (hsa-miR-802, miR-3648 и miR-3687) были сверхэкспрессированы по крайней мере 50% в DS CBMC плода (n = 3) по сравнению с подобранным контролем образцов (рис.3), а еще семь зрелых миРНК, происходящих из Hsa21, остались необнаруженными ПЦР количества стебля-петли во всех образцах. Результаты шести аномально экспрессируемые миРНК, не происходящие из Hsa21, показаны на рис. 4.За исключением miR-233, изменения пяти аномально экспрессируемых миРНК, не происходящих из Hsa21, в группа DS соответствовала секвенированию Illumina Результаты.

    Идентификация нового кандидата миРНК

    Чтобы идентифицировать новые кандидаты miRNA из непревзойденных последовательностей в двух библиотеках, мы сначала удалили аннотированные последовательности, такие как известные miRNA, геномные повторы, кодирующие последовательности и другие малые РНК. Всего 59 098 (P) и 346 626 (N) обнаруженные теги последовательности были получены из неаннотированных областей геном человека.Поскольку прогнозы основаны на идентификации miRNA предшественники, области генома (100 н.), окружающие эти уникальные последовательности были извлечены и проанализированы с помощью MIREAP и miRDeep, которые обычно используются для идентификации новых миРНК-кандидатов из данные высокопроизводительного секвенирования (19,22). Чтобы уменьшить количество ложных срабатываний, только новые миРНК-кандидаты, поддерживаемые этими двумя независимыми инструменты были рассмотрены. Используя этот метод, 181 новый кандидат miRNA были идентифицированы из двух библиотек: 127 miRNA из Группа N и 63 миРНК из группы DS, но 9 миРНК были общими обеими библиотеками.

    Мы заметили, что размер 181 miRNA варьируется от 20 до 24 нт и минимальные свободные энергии их предшественников варьировала от -18,6 до -71,5 ккал / моль при среднем значении -36,1 ккал / моль. Длина шпилечных структур-предшественников варьировала от 61 до 101 н. Следует отметить, что некоторые новые кандидаты миРНК в нашем в наборе данных было от 1 до 7 изомий с различными частотами, которые могут усилить предсказание этих молекул как новых миРНК (28). Дополнительно два романа миРНК-кандидаты (обозначенные как hsa-miR-nov-1 и hsa-miR-nov-2) гены были обнаружены в «критической области DS» человека. хромосома 21 (chr21q22.2 – q22.3) (рис. 5), в котором гены были доказано, что он играет важную роль в патологическом процессе DS (29). Это наблюдение предполагает, что два новых гена miRNA также могут иметь решающее значение в комплексе и вариабельные фенотипы DS таким же образом, как пять известных МикроРНК, происходящие из Hsa21 (т.е. hsa-miR-99a, let-7c, miR-125b-2, miR-155 и miR-802) (1). К Чтобы проверить новые miRNA, мы выполнили qPCR на четырех случайных выбранные новые miRNA (hsa-miR-nov1, hsa-miR-nov2, hsa-miR-nov3 и hsa-miR-nov4), включая три вышеупомянутых кандидата miRNA.В результате мы успешно утвердили четыре романа кандидаты на миРНК. По сравнению с контрольными образцами hsa-miR-nov1 был активирован, а hsa-miR-nov2 и miR-nov4 были подавлено в образцах DS (рис. 6).

    По сравнению с другими миРНК в настоящее время исследования,> 92% предполагаемых новых микроРНК показали более низкий уровень экспрессии с <10 ​​TPM после нормализации для частота секвенирования и только 13 новых miRNA были> 10 TPM. Этот открытие предположило, что большинство предполагаемых новых микроРНК могут не играют значительной роли в DS.Тем не менее, полученный из Hsa21 новые miRNA и новые miRNA, которые измеряют> 10 TPM, могут быть участвует в развитии сложных и вариабельных фенотипов DS и заслуживают дальнейшего функционального исследования.

    Прогнозирование целей и анализ GO

    Для изучения конкретных функций дифференциально экспрессируемые миРНК (кратность изменения> 2,0 и P <0,001) в процессе развития DS плода мРНК мишени каждой дифференциально экспрессируемой miRNA были идентифицированы с помощью Инструмент miRecord (http: // mirecords.biolead.org/), как описано в Материалы и методы. Пять мишеней мРНК (т. Е. SOD1, MXD4, PBX1, BCLAF1 и FOXO1) дифференциально экспрессируемых миРНК были также количественно определяется с помощью кПЦР в (P) и (N) (рис. 7). Изучая «биологические классификации процесса на уровне 5, результаты показали, что кластер чрезмерно представленных терминов GO среди прогнозируемой цели гены микроРНК с повышенной и подавляющей регуляцией у DS плода были участвует в регуляции транскрипции (GO: 0045449, GO: 0045941, GO: 0045893), экспрессия генов (GO: 0010468, GO: 0010628), клеточный биосинтетический процесс (GO: 0031326, GO: 0031328), процесс биосинтеза макромолекул (GO: 0010556, GO: 0010604) и регулирование азотистых оснований, нуклеозидов, нуклеотидов и нуклеиновых кислот метаболический процесс (GO: 0019219) (P <0.001) (рис.8).

    Для очень распространенных (> 1000 TPM) и значимо дифференциально экспрессируемые miRNA, за исключением вышеупомянутой биологической функции, некоторые кластеры важные термины GO и их мРНК-мишени также были связаны с развитием нервной системы, т.е. нейрогенезом (GO: 0022008), генерация нейронов (GO: 0048699), дифференциация нейронов и разработка (GO: 0045664, GO: 0048666), которая может быть связана с патогенезом когнитивных нарушений у пациентов с СД.В результаты также предполагают, что набор очень обильных и значительно дифференцированно экспрессируемые miRNA могут способствовать прогрессирование когнитивных нарушений у пациентов с СД за счет регулирования гены пути развития нервной системы.

    Обсуждение

    Для исследования изменений miRNA в масштабе всего генома. экспрессия плодов СД под влиянием трисомии 21 во время развитие DS плода и определить, есть ли другая miRNA ген расположен на Hsa21, мы глобально исследовали miRNA профили экспрессии у плода DS и их нормальных аналогов с использованием технологии глубокого секвенирования Illumina.Всего 395 известных и В этом эксперименте была идентифицирована 181 новая микроРНК и две новые микроРНК. миРНК-кандидаты были идентифицированы как находящиеся в «DS критическая область 'хромосомы 21 (chr21q22.2–22.3).

    По сравнению с миРНК, общими для двух библиотеки, большинство дифференциально экспрессируемых miRNA, включая четыре микроРНК, происходящие из Hsa21 (hsa-miR-99a, let-7c, miR-125b-2 и miR-155) подавлялись в группе DS. Примечательно, что аберрантная экспрессия этих миРНК, происходящих из Hsa21, в том числе has-miR-802, как было доказано, способствует сложному и вариабельные фенотипы DS (1).MiRNA hsa-miR-155 и miR-802 способны подавлять экспрессию гена MeCP2, ведущего когнитивным нарушениям у лиц с СД (4). Кроме того, hsa-miR-155 также было обнаружено, что он играет важную роль в развитии иммуноцитов во время воспаление через регуляцию Bach2, Sla, Cutl1, Csf1r, Jarid2, Cebp-β, PU.1, Arntl, Hif1-α и Picalm, а его устойчивая экспрессия в гемопоэтических стволовых клетках (HSC) составляет может привести к миелопролиферативному заболеванию (14). MiРНК hsa-miR-99a, let-7c и miR-125b действуют как супрессоры опухолей и способны уменьшать частота солидных опухолей у пациентов с СД (16–18).Однако за исключением hsa-miR-802 сверхэкспрессируется как минимум на 50%, остальные четыре miРНК, происходящие из hsa21, подавлялись в CBMC DS плода в настоящее исследование. Эти результаты не согласуются с предыдущими исследования (3,5), которые описали эти пять miRNA как сверхэкспрессируется в фибробластах DS, клетках мозга и сердца (1). По поводу расхождений между данными, полученными в нашем исследовании и предыдущих исследованиях, наиболее важные причины могут быть связаны с разными образцами (шнур клетки крови и ткани плода).Две группы тщательно проанализировали сверхэкспрессия генов Hsa21 в разных типах трисомных клеток / тканей (30,31). Prandini и др. (31) обнаружили, что когда лимфобластоид клеточные линии сравнивали с клеточными линиями фибробластов, полученными из индивидуумы с DS и эуплоидные контрольные особи, только 39% Гены Hsa21 в линиях лимфобластоидных клеток и 62% в клетках фибробластов линии были чрезмерно выражены. Ли и др. (30) сравнили разницу Hsa21 экспрессия гена между фибробластом и сердцами плода с трисомии 21 и наблюдали, что доля сверхэкспрессируемого Hsa21 гены в фибробластах и ​​сердцах плода различались (29 и 15%, соответственно).Кроме того, расхождения между относительными обилие miRNA, обнаруженное с помощью технологии секвенирования Illumina и КПЦР «стебель-петля» можно объяснить индивидуальным изменением образцы и применение различных методов для miRNA подготовка и анализ данных. Тем не менее, мы можем предварительно описывают профиль экспрессии miRNA CMBC в развитии DS плод. Кроме того, данные, полученные в нашем исследовании, должны быть подтверждено с использованием большего количества образцов пуповинной крови DS.

    Профиль экспрессии miRNA в масштабе всего генома, вероятно, улучшить наше понимание miRNA и их роли в развитие DS плода.Многочисленные идентифицируются по-разному регулируемые miRNAs в этом исследовании, как сообщается, участвуют в различные клеточные процессы, такие как пролиферация клеток, дифференцировка, апоптоз, созревание и активация гранулоцитов. Например, hsa-miR-233, миелоид-специфическая miRNA, отрицательно регулирует пролиферацию миелоидных предшественников, гранулоцитов дифференциации и активации и участвует в поддержании функция нейтрофилов. В отсутствие hsa-miR-233, гранулоциты сверхзрелые и сверхчувствительны к активации раздражители и проявляют повышенную фунгицидную активность (12).Более того, hsa-miR-196b и miR-21 было обнаружено, что они участвуют в гранулопоэзе. Их коэкспрессия может полностью блокировать G-CSF-индуцированный гранулопоэз (32). Кроме того, подавление hsa-miR-21 способно сдерживать генерацию мононуклеарные клетки и дифференцировка дендритных клеток (ДК), приводя к уменьшению генерации постоянного тока, и в результате фагоцитарная функция ингибирования ДК (33). DC, лишенный hsa-miR-155, может дополнительно ухудшают его способность к презентации антигена, делая его неспособным индуцируют эффективную активацию Т-клеток в ответ на антигены (34).Hsa-miR-155, требование miRNA для нормальной иммунной функции, важна для функции B и Т-лимфоциты и дендритные клетки (35). Дефицит Hsa-miR-155 приводит к CD4 + Т-клетки более склонны к дифференцировке Th-2, поскольку по сравнению с Th-1, что приводит к уменьшению количества зародышевых центров В-клетки и внефолликулярные В-клетки, при этом В-клетки не могут продуцируют высокоаффинные антитела IgG (36). Кроме того, некоторые миРНК, в том числе hsa-miR-125a, miR-125b, miR-99b и let-7e предпочтительно являются выражается активно делящимися центробластами в зародышевых центрах и сверхэкспрессия hsa-miR-125b способна ингибировать дифференцировка первичных В-клеток (37).

    Классификации ГО «биологический процесс» показали что категории GO связаны с регуляцией транскрипции, экспрессия генов, клеточный биосинтетический процесс, макромолекула биосинтетический процесс и регуляция азотистых оснований, нуклеозидов, метаболические процессы нуклеотидов и нуклеиновых кислот были обогащены среди гены-мишени для значительно дифференциально экспрессируемых miRNA в DS CBMC плода. Большинство мишеней мРНК в этих категории имеют хорошо задокументированную связь с иммунными модуляция, включая SOD1, MXD4, PBX1, BCLAF1 и FOXO1.Эти гены были нацелены на hsa-miR-1, miR-320b, miR-196b, miR-4732-5p и miR-486-5p соответственно. SOD1 ген был локализован в «критическом регионе DS» хромосомы 21. Сверхэкспрессия SOD1 может привести к снижению лимфопролиферативные реакции, усиление некроза и апоптоз Т-клеток in vitro и играет решающую роль в Функциональный дефицит Т-клеток (38). MXD4, член сети Myc-Max-Mad, доказал свою эффективность. быть связанным с выживанием Ag-специфических Т-клеток.В подавление MXD4 может привести к увеличению T-клеток смерть (39). Как крупный глобальный развивающий регулятор, АТС1 участвует в продвижении пролиферации клеток-предшественников во многих тканях и имеет решающую роль в поддержании послеродового кроветворения. отсек. Удаление PBX1 в тимусе может привести к Редукция клеток Т- и В-линий (40). Фактор 1, связанный с Bcl-2 (BCLAF1) является ядерным белком, который необходим для правильного гомеостаза T- и B-клеточные клоны и индуцированная активацией пролиферация T ячейки (41).Было обнаружено, что новорожденные с дефицитом Bclaf1, проявляющие Т-клетки, иметь зависимый от активации дефект пролиферации ex vivo (42). Кроме того, Фактор транскрипции Forkhead-box (FOXO1) имеет решающее значение в поддержание гомеостаза иммунной системы и предпочтительно экспрессируется в зрелых периферических Т- и В-клетках (43). Конститутивное удаление Foxo1 в линии T-клеток, а также острая делеция могут приводят к дефектам самонаведения Т-лимфоцитов в периферических лимфоидных органах (44). FOXO1-дефицитный зрелые В-клетки могут не пройти рекомбинацию с переключением класса с в результате дефицит продукции IgG (45).В сочетании с уменьшением количество иммунных клеток в системе кровообращения (46) и инфекции (47), представленных у пациентов с СД, мы экстраполировать, что дифференциально экспрессируемые miRNA могут быть участвует в нарушениях кроветворения и иммунных дефектах DS плоды и новорожденные.

    Следует отметить, что за исключением вышеупомянутых результаты, целевое предсказание паттерна miRNA также показало, что некоторые очень распространены и выражены значительно по-разному miRNAs могут быть связаны с нервной системой развитие, т.е., нейрогенез, генерация нейронов, нейрон дифференциация и развитие. Примечательно, что мы обнаружили, что нервные гены развития системы BDNF и CDK5R1 были мишени miRNA семейства mir-103 (miR-103a / 107). BDNF и CDK5R1 важны для пролиферации нейронов, дифференцировка, выживаемость и миграция нейронов (48,49), предполагая, что семейство mir-103 члены могут быть связаны с патогенезом когнитивных нарушение у пациентов с СД. Когнитивные нарушения были обычным вредоносный фенотип всех пациентов с СД.Дополнительный исследование паттернов дифференциальной экспрессии miRNA, вместе с последующей информацией в клинике может выявить сигнатура miRNA как биомаркер для выявления когнитивных нарушение у пациентов с СД.

    Другой целью данного исследования было определить, другой ген miRNA находится в хромосоме 21 человека. Примечательно, что 2 из 181 новой миРНК-кандидата (hsa-miR-nov1 и hsa-miR-nov2) были идентифицированы в «критической области DS» хромосомы 21 человека. (Рис. 5).Длина hsa-miR-nov1 и hsa-miR-nov2 составляют 23 и 21 нт соответственно. В минимальная свободная энергия обеих новых миРНК ниже -18 ккал / моль. Используя платформу UCSC, мы обнаружили, что Ген hsa-miR-nov1 находится в антисмысловой ориентации внутри интрон 9 гена β-сайта фермента 2 расщепления АРР (BACE2), который расположен на chr21q22.2–22.3 и играет важную роль при нейродегенерации и последующей деменции при AD и DS (50,51). Hsa-miR-nov2 находится ~ 2.6 миллионов пар оснований ниже гена hsa-miR-nov1 в смысловая ориентация внутри интрона 11 пиридоксалкиназы человека (PDXK) ген в позиции q22 генома Hsa21.3. Примечательно, что механизм экспрессии miRNA (10) предполагает, что экспрессия hsa-miR-nov1 и hsa-miR-nov2 могут быть связаны с BACE2 и PDXK соответственно.

    Размышлять о функции этих двух романов. кандидаты miRNA, TargetScanS Custom (версия 5.2) и GO. предсказывать их предполагаемые цели и анализировать их биологические функции соответственно. Результаты показали, что hsa-miR-nov1 имеет 211 консервативных мишеней, включая ген MECP2, который также мишень для hsa-miR-155, miR-802, let-7c и miR-125b (1) и может быть связан с когнитивные нарушения у лиц с DS (4).МикроРНК hsa-miR-nov2 регулирует 101 консервативные мишени, всего 105 консервативных сайтов. Кластер чрезмерно представленных классов GO в прогнозируемых целях двух новые miRNA показывают, что эти miRNA в основном связаны с регионализация (GO: 0003002), регуляция дифференцировки клеток (GO: 0045595, GO: 0045646 и GO: 0045637), эмбриональный морфогенез и разработка (GO: 0048598 и GO: 0009790) и ионный транспорт (GO: 0006811). Однако, хотя мы определили, что hsa-miR-nov1 и hsa-miR-nov2 были активированы и подавлены в DS CBMC плода (рис.6), соответственно, регуляторные механизмы двух новых микроРНК еще предстоит подтвердить.

    В заключение, настоящее исследование предоставило значительное понимание понимания выражения характеристика miRNA в DS CBMC плода и что дифференциально экспрессируемые миРНК могут участвовать в кроветворении. аномалии и иммунные дефекты, наблюдаемые у DS плодов и новорожденные. Кроме того, некоторые очень распространенные и дифференцированно экспрессируемые miRNA могут быть вовлечены в путь когнитивного ухудшение состояния пациентов с СД.Насколько нам известно, это первое исследование по изучению профилей экспрессии miRNA в масштабе всего генома у плода DS. Примечательно, что механизм регулирования аннотированных - и miRNA, происходящие из нового hsa21, в развитии клеток крови DS и связь между миРНК, производными от hsa21, и различными фенотипы DS требуют дальнейшего изучения. В частности, значительно дифференцированно и специфически экспрессируемые miRNA имеют потенциал быть выбранным в качестве биомаркеров для построения новый метод антенатальной диагностики плода DS.

    Благодарности

    Благодарим пациентов за участие в эта учеба. Мы благодарим доктора Цзяньхуа Яна (Университет Сунь Ятсена, Гуанчжоу, Китай) и Ванминь Цяо (BGI, Шэньчжэнь, Китай) за полезные комментарии относительно анализа данных. Мы будем также хотел бы поблагодарить Чжаоян Луо (Харбинский технологический институт Shenzhen Graduate School, Шэньчжэнь, Китайская Народная Республика) за его технические помощь. Это исследование было поддержано ключевым проектом Шэньчжэня. Научно-техническая программа (№201001006) и провинции Гуандун S&T программа (№ 2012B032000008).

    Список литературы

    1

    Элтон Т.С., Сансом С.Е. и Мартин ММ: Дозировка гена трисомии-21 сверхэкспрессии миРНК приводит к гаплонедостаточность конкретных белков-мишеней. RNA Biol. 7: 540–547. 2010. Просмотр статьи: Google Scholar: PubMed / NCBI

    2

    Козомара А. и Гриффитс-Джонс S: miRBase: интеграция аннотации микроРНК и данных глубокого секвенирования.Нуклеиновая Acids Res. 39: D152–157. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

    3

    Kuhn DE, Nuovo GJ, Martin MM, et al: Human miRNA, происходящие из хромосомы 21, сверхэкспрессируются при синдроме Дауна мозги и сердца. Biochem Biophys Res Commun. 370: 473–477. 2008 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    4

    Kuhn DE, Nuovo GJ, Terry AV Jr и др.: МикроРНК, происходящие из хромосомы 21, обеспечивают этиологическую основу для аберрантная экспрессия белка в мозге человека с синдромом Дауна.J Biol Chem. 285: 1529–1543. 2010. Просмотр статьи: Google Scholar: PubMed / NCBI

    5

    Сетупати П., Борел С., Гагнебин М. и др.: МикроРНК-155 человека на 21 хромосоме дифференциально взаимодействует с его полиморфная мишень в 3'-нетранслируемой области AGTR1: a механизм функциональных однонуклеотидных полиморфизмов, связанных с фенотипы. Am J Hum Genet. 81: 405–413. 2007. PubMed / NCBI

    6

    Льюис Б.П., Бердж CB и Бартель Д.П .: Консервативное соединение семян, часто окруженное аденозинами, указывает на то, что тысячи человеческих генов являются мишенями для микроРНК.Клетка. 120: 15–20. 2005. Просмотр статьи: Google Scholar: PubMed / NCBI

    7

    Ченг А.М., Байром М.В., Шелтон Дж. И Форд ЛП: Антисмысловое ингибирование человеческих miRNA и показания для участие miRNA в росте и апоптозе клеток. Нуклеиновые кислоты Res. 33: 1290–1297. 2005. Просмотр статьи: Google Scholar: PubMed / NCBI

    8

    Чен Ц.З., Ли Л., Лодиш Х.Ф. и Бартель Д.П .: МикроРНК модулируют дифференцировку гемопоэтических клонов.Наука. 303: 83–86. 2004. Просмотр статьи: Google Scholar: PubMed / NCBI

    9

    Ваз К., Ахмад Х.М., Шарма П. и др.: Анализ. транскриптома микроРНК путем глубокого секвенирования библиотек малых РНК периферической крови. BMC Genomics. 11: 2882010. Просмотр статьи: Google Scholar: PubMed / NCBI

    10

    Бартель Д.П.: МикроРНК: геномика, биогенез, механизм и функции. Клетка.116: 281–297. 2004 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    11

    Bandiera S, Hatem E, Lyonnet S и Генрион-Код А: микроРНК при заболеваниях: от кандидата до модификатора гены. Clin Genet. 77: 306–313. 2010. Просмотр статьи: Google Scholar: PubMed / NCBI

    12

    Авеланж V и Гарсон Р: МикроРНК: появляются ключевые регуляторы кроветворения. Am J Hematol. 85: 935–942.2010. Просмотр статьи: Google Scholar: PubMed / NCBI

    13

    Szulwach KE, Jin P и Alisch RS: Некодирующие РНК при умственной отсталости. Clin Genet. 75: 209–219. 2009 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    14

    О'Коннелл Р.М., Рао Д.С., Чаудхури А.А. и др.: Устойчивая экспрессия микроРНК-155 в гемопоэтических стволовых клетках вызывает миелопролиферативное заболевание. J Exp Med.205: 585–594. 2008 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    15

    Малинг С., Израэли С. и Криспино Дж. Д.: Понимание проявлений, результатов и механизмов лейкемогенез при синдроме Дауна. Кровь. 113: 2619–2628. 2009 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    16

    Озен М, Крейтон CJ, Оздемир М и Иттманн М.: Широко распространенное нарушение регуляции экспрессии микроРНК у человека. рак простаты.Онкоген. 27: 1788–1793. 2008. Просмотр статьи: Google Scholar: PubMed / NCBI

    17

    Нагаяма К., Коно Т., Сато М., Арай Й., Минна JD и Yokota J: сканирование с гомозиготными делециями рака легких геном с разрешением 100 kb. Гены Хромосомы Рак. 46: 1000–1010. 2007. Просмотр статьи: Google Scholar: PubMed / NCBI

    18

    Калин Г.А., Севиньяни С., Думитру С.Д. и др.: Гены микроРНК человека часто расположены в уязвимых местах и области генома, участвующие в раковых заболеваниях.Proc Natl Acad Sci U S A. 101: 2999–3004. 2004. Просмотр статьи: Google Scholar: PubMed / NCBI

    19

    Крейтон CJ, Рид JG и Гунаратне PH: Профилирование экспрессии микроРНК с помощью глубокого секвенирования. Краткий Биоинформ. 10: 490–497. 2009. Просмотр статьи: Google Scholar

    20

    Li R, Yu C, Li Y и др.: SOAP2: an улучшенный сверхбыстрый инструмент для выравнивания при коротком считывании. Биоинформатика.25: 1966–1967. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

    21

    Андерс С. и Хубер В. Дифференциал экспрессионный анализ данных подсчета последовательностей. Genome Biol. 11: R1062010. Просмотр статьи: Google Scholar: PubMed / NCBI

    22

    Сюй Г, Ву Дж, Чжоу Л. и др.: Характеристика транскриптомов малых РНК андрогенов зависимая и независимая клеточная линия рака простаты глубоким последовательность действий.PLoS One. 5: e155192010. Просмотр статьи: Google Scholar: PubMed / NCBI

    23

    Чен Х, Ли Кью, Ван Дж и другие: Идентификация и характеристика новых микроРНК amphioxus с помощью Секвенирование Solexa. Genome Biol. 10: R782009. Просмотр статьи: Google Scholar: PubMed / NCBI

    24

    An J, Lai J, Lehman ML и Nelson CC: miRDeep *: интегрированный прикладной инструмент для идентификации miRNA из данных секвенирования РНК.Nucleic Acids Res. 41: 727–737. 2013.

    25

    Кастильо-Дэвис К.И. и Хартл Д.Л.: GeneMerge-постгеномный анализ, интеллектуальный анализ данных и гипотезы тестирование. Биоинформатика. 19: 891–892. 2003. Просмотр статьи: Google Scholar: PubMed / NCBI

    26

    Шульман Б.Р., Эскела-Кершер А. и Слэк. FJ: Взаимная экспрессия lin-41 и микроРНК let-7 и mir-125 во время эмбриогенеза мышей.Dev Dyn. 234: 1046–1054. 2005 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    27

    Вульчин Ф.Г., Смирнова Л., Рыбак А. и др .: Посттранскрипционная регуляция микроРНК let-7 во время нервной спецификация ячейки. FASEB J. 21: 415–426. 2007. Просмотр статьи: Google Scholar: PubMed / NCBI

    28

    Морин Р.Д., О'Коннор, доктор медицины, Гриффит М. и др.: Применение массового параллельного секвенирования для профилирования микроРНК и открытие эмбриональных стволовых клеток человека.Genome Res. 18: 610–621. 2008. Просмотр статьи: Google Scholar: PubMed / NCBI

    29

    Паттерсон Д: Молекулярно-генетический анализ Синдром Дауна. Hum Genet. 126: 195–214. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

    30

    Ли СМ, ​​Го М., Салас М. и др.: Cell типоспецифическая сверхэкспрессия генов хромосомы 21 в фибробластах и сердца плода с трисомией 21. BMC Med Genet.7: 242006.PubMed / NCBI

    31

    Прандини П., Дойч С., Лайл Р. и др.: Естественные вариации экспрессии генов при синдроме Дауна модулируют результат дисбаланса дозировки гена. Am J Hum Genet. 81: 252–263. 2007 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    32

    Велу CS, Бактула AM и Граймс HL: Gfi1 регулирует miR-21 и miR-196b для контроля миелопоэза. Кровь. 113: 4720–4728.2009. Просмотр статьи: Google Scholar: PubMed / NCBI

    33

    Грасиас Д.Т. и Кацикис П.Д.: МикроРНК: ключ компоненты иммунной регуляции. Adv Exp Med Biol. 780: 15–26. 2011 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    34

    Лу LF и Листон A: МикроРНК в иммунной система, микроРНК как иммунная система. Иммунология. 127: 291–298. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

    35

    Родригес А., Вигорито Э., Клэр С. и др.: Необходимость bic / microRNA-155 для нормальной иммунной функции.Наука. 316: 608–611. 2007. Просмотр статьи: Google Scholar: PubMed / NCBI

    36

    Фернандо Т.Р., Родригес-Малаве Н.И. и Рао DS: МикроРНК в развитии В-клеток и злокачественных новообразованиях. J Hematol Онкол. 5: 72012. Просмотр статьи: Google Scholar: PubMed / NCBI

    37

    Гурураджан М., Хага С.Л., Дас С. и др.: Подавление микроРНК 125b дифференцировки В-клеток в зародышевых центры. Int Immunol.22: 583–592. 2010. Просмотр статьи: Google Scholar: PubMed / NCBI

    38

    Банерджи Р., Мосли Р.Л., Рейнольдс А.Д. и др.: Адаптивная иммунная нейропротекция при боковой амиотрофии G93A-SOD1 склероз мышей. PLoS One. 3: e27402008. Просмотр статьи: Google Scholar: PubMed / NCBI

    39

    Василевский Н.А., Ruby CE, Hurlin PJ и Вайнберг А.Д.: вовлечение OX40 стабилизирует уровни белков Mxd4 и Mnt в антиген-стимулированных Т-клетках, что приводит к увеличению клеточного выживание.Eur J Immunol. 41: 1024–1034. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

    40

    Фикара Ф., Мерфи М.Дж., Лин М. и Клири М.Л .: Pbx1 регулирует самообновление долгоживущих гемопоэтических стволовых клеток сохраняя их неподвижность. Стволовая клетка. 2: 484–496. 2008 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    41

    Макферсон Дж. П., Саррас Х., Леммерс Б. и др.: Важная роль Bclaf1 в развитии легких и иммунной системе функция.Смерть клетки отличается. 16: 331–339. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

    42

    Саррас Х., Ализаде Азами С. и Макферсон JP: В поисках функции для BCLAF1. Научный мировой журнал. 10: 1450–1461. 2010. Просмотр статьи: Google Scholar: PubMed / NCBI

    43

    Дежан А.С., Хедрик С.М. и Кердилес Ю.М.: Высокоспециализированная роль факторов транскрипции Forkhead box O в иммунная система.Антиоксидный окислительно-восстановительный сигнал. 14: 663–674. 2011 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    44

    Оуян В., Беккет О., Флавелл Р.А. и Ли МО: Существенная роль фактора транскрипции Forkhead-box Foxo1 в контроль гомеостаза и толерантности Т-клеток. Иммунитет. 30: 358–371. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

    45

    Денглер Х.С., Барачо Г.В., Омори С.А. и др.: Различные функции фактора транскрипции Foxo1 в различных этапы дифференцировки В-клеток.Nat Immunol. 9: 1388–1398. 2008 г. Просмотр статьи: Google Scholar: PubMed / NCBI

    46

    де Хинг Ю.К., ван дер Фоссен П.В., Гемен Э.Ф., и др.: Внутренние аномалии количества лимфоцитов у детей. с синдромом Дауна. J Pediat. 147: 744–747. 2005. PubMed / NCBI

    47

    Рам Джи и Чинен Дж .: Инфекции и иммунодефицит при синдроме Дауна. Clin Exp Immunol. 164: 9–16. 2011 г.Просмотр статьи: Google Scholar: PubMed / NCBI

    48

    Ли Дж., Дуан В. и Мэттсон MP: Доказательства что нейротрофический фактор головного мозга необходим для базального нейрогенез и частично опосредует усиление нейрогенеза путем ограничения питания в гиппокампе взрослых мышей. J Neurochem. 82: 1367–1375. 2002. Просмотр статьи: Google Scholar: PubMed / NCBI

    49

    Зуккотти П., Барбьери А., Коломбрита С. и др. al: Идентификация посттранскрипционных регуляторных элементов в Ген 3′UTR CDK5R1 участвует в развитии и функционировании ЦНС.Евро J Hum Genet. 19: 3542011.

    50

    Холлер С.Дж., Уэбб Р.Л., Лаукс А.Л. и др .: BACE2. экспрессия увеличивается при нейродегенеративном заболевании человека. Am J Патол. 180: 337–350. 2012. Просмотр статьи: Google Scholar: PubMed / NCBI

    51

    Уэбб Р.Л. и Мерфи М.П.: β-секреты, Болезнь Альцгеймера и синдром Дауна. Curr Gerontol Geriatr Res. 2012: 3628392012.

    Симпозиум на 26-м ежегодном собрании Японского общества генетики человека, 1981: Генетические маркеры в крови Генетические маркеры

  • Alper, C.A., Boemisch, T. и Watson, L. 1972. Генетический полиморфизм в человеческом глициновом бета-гликопротеине. J. Exp. Med. 135 : 68–80.

    CAS Статья PubMed PubMed Central Google Scholar

  • Альпер, К.А., и Розен, Ф.С. 1976. Генетика системы комплемента. В Успехах в области генетики человека, 7 гл. 4 , Харрис, Х. и Хиршхорн, К., ред., Plenum Press, Нью-Йорк.

    Google Scholar

  • Альпер, К.A. 1976. Унаследованный структурный полиморфизм C2 человека: доказательства генетической связи между C2 и BF. J. Exp. Med. 144 : 1111–1115.

    CAS Статья PubMed Google Scholar

  • Девальд, Г. и Риттнер, К. 1979. Полиморфизм второго компонента человеческого комплемента (C2). Vox Sang 37 : 47–54.

    CAS Статья PubMed Google Scholar

  • Фархуд, Д.Д., Анантакришнан Р. и Уолтер Х. 1972. Связь между фенотипами C3 и различными заболеваниями. Humangenetik 17 : 57–60.

    CAS PubMed Google Scholar

  • Харада С., Мано К. и Мисава С. 1975. Генетический полиморфизм третьего компонента комплемента (C3) (на японском языке). Jpn. J. Human Genet. 20 : 141–146.

    CAS Google Scholar

  • Хауптманн, Г., Tongio, M.M., and Mayer, S. 1976. Le polymorphisme du facteur B де ла пропердина (C3PA, GBG, BF) и связующего гистосовместимого комплемента. Ред. Трансфус. Иммуно-гематол. 19 : 471–486.

    CAS Статья PubMed Google Scholar

  • Хобарт, М.Дж., Ваз Гуэдес, М.А., и Лахманн, П.Дж., 1981. Полиморфизм человеческого C5. Ann. Гм. Genet. 45 : 1–4.

    CAS Статья PubMed Google Scholar

  • Горай, С.1976. Генетический полиморфизм человеческого сывороточного фактора B (BF) на японском языке. Jpn. J. Human Genet. 21 : 177–186.

    CAS Google Scholar

  • Кирк, Р.Л., Серджантсон, С.В., Теофилус, Дж., Зиммет, П., Уайтхаус, С., и Корт, Дж. М. 1979. Возрастное соотношение между инсулинозависимым диабетом и редкими аллелями фактора пропердина B. Lancet II : 537.

    Артикул Google Scholar

  • Кирк Р.Л., Рэнфорд, П.Р., Корт, Дж. И Зиммет, П. 1980. Распределение типов комплемента C′2 и C′6 в австралийских случаях сахарного диабета. Med. J. Aust. 2 : 614–615.

    CAS PubMed Google Scholar

  • Лахман П.Дж. и Хобарт М.Дж. 1978. Генетика комплемента в отношении HLA. Brit. Med. Бык. 34 : 247–252.

    Google Scholar

  • Мауф, Г., Хаммел, К., и Пульверер, К. 1975. Полиморфизм фактора В пропердина (богатый глицином бета-гликопротеин или проактиватор С3): генетические и биохимические аспекты. Первое заявление об установлении отцовства. Z. Immun.-Forsch. 150 : 327–338.

    CAS Google Scholar

  • Mauff, G., Gauchel, F.D., and Hitzeroth, H.W. 1976. Полиморфизм фактора пропердина B в южноафриканских негроидных, индийских и цветных популяциях. Гум.Genet. 33 : 319–322.

    CAS Статья PubMed Google Scholar

  • Meo, T., Atkinson, JP, Bernoco, M., Bernoco, D., and Ceppellini, R. 1977. Структурная гетерогенность белка комплемента C2 и его генетических вариантов у человека: новый полиморфизм области HLA . Proc. Natl. Акад. Sci. США . 74 : 1672–1675.

    CAS Статья PubMed PubMed Central Google Scholar

  • Мортенсен, Дж.П., Ламм Л.У. 1981. Количественные различия между фенотипами фактора комплемента-B. Иммунология 42 : 505.

    CAS PubMed PubMed Central Google Scholar

  • Нисимукай, Х., Саката, К., Ямасава, К., Хёдо, Ю., Косуге, К., Ядзаки, Т., и Китамура, Х. 1979. (Личное сообщение)

  • Охайон , Э., Де Музон, А., Хауптманн, Г., Кляйн, Дж., Аббал, М., Констанс, Дж., Майер, С., и Дюкос, Дж. 1980. Высокая частота фактора пропердина Bf F1 и его связь с HLA у французских басков. J. Immunogenet. 7 : 441–445.

    CAS Статья PubMed Google Scholar

  • Олайсен, Б., Тейсберг, П., Гедде-Даль, Т. младший, и Торсби, Э. 1978. Генетический полиморфизм второго компонента человеческого комплемента (C2). Гум. Genet. 42 : 301–305.

    CAS Статья PubMed Google Scholar

  • О'Нил, Г.J., Yang, S.Y., и Dupont, B. 1978. Два HLA-сцепленных локуса, контролирующих четвертый компонент человеческого комплемента. Proc. Natl. Акад. Sci. США 75 : 5165–5169.

    Артикул PubMed PubMed Central Google Scholar

  • Риттнер, Ч., и Бертрамс, Дж. 1981. Одно из значений полиморфизмов С2, С4 и фактора В при заболевании. Гум. Genet. 56 : 235–247.

    CAS Статья PubMed Google Scholar

  • Родригес-Кордиба, С., Bootello, A., и Arnaiz-Villena, A. 1981. Полиморфизм BF и его связь с антигенами HLA в выборке испанской популяции: высокие частоты F1 BF. Тканевые антигены 17 : 231–237.

    Артикул Google Scholar

  • Scherz, R., Pflugshaupt, R., and Butler, R. 1977 г. Генетический полиморфизм и богатый глицином β-гликопротеин в популяциях Швейцарии и Италии. Гум. Hered. 27 : 143–146.

    CAS Статья PubMed Google Scholar

  • Стюарт Г.Дж., Бастен А. и Кирк Р.Л. 1979. Сильное неравновесие по сцеплению между HLA-Dw2 и Bf S при множественном селозе и в нормальной популяции. Тканевые антигены 14 : 86–97.

    CAS Статья PubMed Google Scholar

  • Тейсберг, П., и Олайзен, Б. 1977.Полиморфизм фактора B пропердина (BF) в Норвегии. Vox Sang. 32 : 52–55.

    CAS Статья PubMed Google Scholar

  • Токунага К., Хораи С., Омото К., Джуджи Т. и Накадзима Х. 1979. Генетический полиморфизм четвертого компонента на японском языке. Jpn. J. Human Genet. 24 : 69–74.

    CAS Статья Google Scholar

  • Токунага, К., Омото, К., Араки, С., и Джуджи, Т. 1980. Генетический полиморфизм второго компонента человеческого комплемента (C2) на японском языке. Jpn. J. Human Genet. 25 : 287–293.

    CAS Статья Google Scholar

  • Токунага К., Омото К., Маэда Х., Джуджи Т., Исиба С. и Маруяма Х. 1981a. Полиморфизм BF и C2 у японских пациентов с ювенильным сахарным диабетом: наличие вариантного аллеля BF. Тканевые антигены 18 : 365–368.

    CAS Статья PubMed Google Scholar

  • Токунага К., Араки К., Джуджи Т. и Омото К. 1981b. Генетический полиморфизм комплемента C2 (на японском языке). Гум. Genet. 58 : 213–216.

    CAS Статья PubMed Google Scholar

  • Токунага, К., Араки, К., Джуджи, Т. и Омото, К. 1982. Полиморфизм фактора пропердина B в японском языке: описание редкого варианта и данные ассоциации с HLA и C2. Гум. Genet. 60 : 42–45.

    CAS Статья PubMed Google Scholar

  • % PDF-1.6 % 2588 0 объект > эндобдж xref 2588 158 0000000016 00000 н. 0000007163 00000 н. 0000007392 00000 н. 0000007525 00000 н. 0000007563 00000 н. 0000007812 00000 н. 0000008039 00000 н. 0000008202 00000 н. 0000008347 00000 п. 0000008540 00000 н. 0000008686 00000 п. 0000008878 00000 н. 0000009024 00000 н. 0000009217 00000 п. 0000009409 00000 п. 0000009555 00000 н. 0000009748 00000 н. 0000009894 00000 н. 0000010088 00000 п. 0000010233 00000 п. 0000010426 00000 п. 0000010570 00000 п. 0000010765 00000 п. 0000010910 00000 п. 0000011105 00000 п. 0000011250 00000 п. 0000011445 00000 п. 0000011640 00000 п. 0000011834 00000 п. 0000012029 00000 н. 0000012224 00000 п. 0000012418 00000 п. 0000012611 00000 п. 0000012755 00000 п. 0000012950 00000 п. 0000013095 00000 п. 0000013290 00000 н. 0000013485 00000 п. 0000013629 00000 п. 0000013824 00000 п. 0000014019 00000 п. 0000014182 00000 п. 0000014328 00000 п. 0000014662 00000 п. 0000015863 00000 п. 0000017059 00000 п. 0000018261 00000 п. 0000019477 00000 п. 0000020669 00000 н. 0000021512 00000 п. 0000021761 00000 п. 0000022948 00000 н. 0000023099 00000 п. 0000023208 00000 п. 0000023319 00000 п. 0000023916 00000 п. 0000024188 00000 п. 0000024333 00000 п. 0000025151 00000 п. 0000025756 00000 п. 0000025865 00000 п. 0000026390 00000 п. 0000026480 00000 п. 0000026735 00000 п. 0000027255 00000 п. 0000027542 00000 п. 0000028085 00000 п. 0000028114 00000 п. 0000028551 00000 п. 0000031813 00000 п. 0000034709 00000 п. 0000037608 00000 п. 0000037631 00000 п. 0000040658 00000 п. 0000043880 00000 п. 0000047082 00000 п. 0000048343 00000 п. 0000051609 00000 п. 0000054919 00000 п. 0000064948 00000 н. 00001 00000 н. 0000247084 00000 н. 0000250499 00000 н. 0000250756 00000 н. 0000252199 00000 н. 0000306034 00000 н. 0000307235 00000 н. 0000307647 00000 н. 0000319323 00000 н. 0000319593 00000 н. 0000319782 00000 н. 0000367171 00000 н. 0000367242 00000 н. 0000422836 00000 н. 0000423101 00000 п. 0000423666 00000 н. 0000424777 00000 н. 0000425075 00000 н. 0000425538 00000 н. 0000426011 00000 н. 0000426272 00000 н. 0000426685 00000 н. 0000427022 00000 н. 0000427113 00000 н. 0000427251 00000 н. 0000427370 00000 н. 0000427681 00000 н. 0000427731 00000 н. 0000427976 00000 н. 0000428059 00000 н. 0000428184 00000 н. 0000428259 00000 н. 0000428550 00000 н. 0000428622 00000 н. 0000428733 00000 н. 0000428848 00000 н. 0000428922 00000 н. 0000429097 00000 н. 0000429171 00000 н. 0000429420 00000 н. 0000429492 00000 н. 0000429631 00000 н. 0000429748 00000 н. 0000429945 00000 н. 0000430017 00000 н. 0000430154 00000 н. 0000430226 00000 н. 0000430300 00000 п. 0000430463 00000 н. 0000430537 00000 п. 0000430690 00000 н. 0000430764 00000 н. 0000430931 00000 н. 0000431005 00000 н. 0000431160 00000 н. 0000431234 00000 н. 0000431367 00000 н. 0000431441 00000 н. 0000431590 00000 н. 0000431664 00000 н. 0000431795 00000 н. 0000431869 00000 н. 0000432006 00000 н. 0000432080 00000 н. 0000432221 00000 н. 0000432295 00000 н. 0000432440 00000 н. 0000432514 00000 н. 0000432651 00000 п. 0000432725 00000 н. 0000432864 00000 н. 0000432936 00000 н. 0000433091 00000 н. 0000433163 00000 п. 0000433318 00000 п. 0000433390 00000 н.

    Автор: alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *