Сайлентблок передней балки 2110: Замена сайлентблоков передней балки на ВАЗ-2110: видео и фото

Содержание

Замена сайлентблоков передней балки на ВАЗ-2110: видео и фото

Одним из самых основных узлов автомобиля, отвечающих за комфорт и безопасность передвижения ВАЗ-2110, является подвеска. Не стоит думать, что главное в подвеске – это амортизаторы, колёса и пружины. Такие небольшие детали, как сайленблоки, непосредственно влияют на работу подвески. Подвеска любого современного автомобиля включает в себя множество этих резиновых деталей.

Поменять сайленблоки передней балки, как и остальные подобные элементы – это довольно проблематичный процесс. Однако если приобрести или одолжить специальные съёмники, эту процедуру можно легко выполнить своими руками.

Для чего нужны сайленблоки в передней подвеске?

Износ сайлентблока.

Некоторые начинающие водители, которых достаточно много среди владельцев ВАЗ-2110, считают, что при ремонте передней подвески нужно в первую очередь обращать внимание на рычаги, балки и амортизаторы. Такие незаметные и простые детали, как резиновые сайленблоки, зачастую просто игнорируются. Тем не менее

именно данные детали обеспечивают надёжное соединение между рычагами подвески.

Хотя сайленблоки не являются расходным материалом, резина со временем, имеет тенденцию к разрушению. Жёсткие условия эксплуатации, особенно по дорогам с некачественным покрытием, тоже влияют на эти детали. Выход из строя сайленблока может спровоцировать трение между металлическими частями подвески, и выход их из строя. Поэтому важно следить за состоянием этих резиновых деталей подвески.

Диагностика сайленблоков

При сильно разбитых сайлентблоках колесо начинает задевать за подкрылок.

Для того чтобы проверить состояние сайленблоков передней балки, можно поступить двумя способами:

  1. Проще всего сделать диагностику подвески на СТО. Хотя некоторые недобросовестные мастера могут «обнаружить» множество неполадок, в надежде получить больше денег за ремонт.
  2. Опытному водителю достаточно проехать на машине несколько километров, слушая, как работает передняя подвеска, чтобы понять, в чём проблема.

Слушая работу подвески, нужно обращать внимание на следующие нюансы:

  1. Во время езды слышится характерный скрип резины. Данные звуки могут быть еле слышными, но их наличие чаще всего свидетельствует об износе сайленблоков. В этом случае автомобиль загоняется на яму, а резиновые детали проверяются на предмет разрывов или трещин. Если сайленблок с трещиной может ещё прослужить некоторое время, то порванная деталь должна быть заменена немедленно.
  2. В случае появления характерных металлических стуков в районе передней подвески, нужно как можно быстрее гнать автомобиль на смотровую яму. Как правило, это показывает на максимальный износ резиновых деталей подвески.

Если затянуть с заменой изношенных сайленблоков, может выйти из строя передняя балка, причём в ряде случаев её придётся полностью менять.

Подготовка к работе по замене сайленблоков

Для запрессовки новых сайлентблоков понадобится специальный съемник.

Перед тем, как начать процесс замены деталей подвески своими руками, нужно подготовить место и набор инструментов. В качестве места идеально подойдёт гараж с просторной смотровой ямой. Что касается инструментов, то для замены понадобится:

  1. Набор ключей и головок с трещоткой.
  2. Специальный съёмник для выпрессовки сайленблоков. Этот специфический инструмент можно или купить, или попросить у знакомых гаражных мастеров на время работы.
  3. ВД-40 или аналоги.
  4. Мыльный раствор.

Нужный съёмник довольно несложно сделать из подходящей по размеру трубы, длинного болта и шайбы.

Если съёмник достать не удастся, можно воспользоваться доступным оборудованием. В этом качестве может выступать подходящая по диаметру трубка с шайбами и тиски.

Процесс замены

Если замена резиновых деталей подвески для автовладельца в новинку, сразу может показаться, что это очень трудоёмкая и сложная процедура. Часто на этапе осмотра неопытные владельцы ВАЗ-2110 решают, что самостоятельно у них ничего не получится. На самом деле, процесс замены достаточно простой. Если сделать это однократно, в дальнейшем менять любые сайленблоки будет легко и просто.

Единственной проблемой может стать запрессовка нового сайленблока на место, так как новые детали могут быть плохо обработаны или слишком жёсткими. Особенно это касается деталей из полиуретана.

Резиновый сайлентблок.

Полиуретановые сайлентблоки.

Замена происходить по следующему алгоритму:

  1. Сначала нужно поднять переднее колесо с помощью домкрата. Домкрат желательно брать гидравлический, а под задние колёса с двух сторон подкладываются противооткатные фиксаторы. Домкрат желательно продублировать подпоркой. Так машина точно не соскочит и не придавит своего владельца.

    Снимаем колесо.

  2. Далее нужно открутить и снять колесо.
  3. В этот момент можно проверить и сайленблоки, которые находятся в рычагах. Если они болтаются, то нужно заменить и их.
  4. Выбивается передняя опора. Перед этим следует открутить гайку, которая удерживает её. Удар должен быть меткий, но не сильный.

    Откручиваем гайку сабли.

  5. После этого можно снимать верхний рычаг. Для этого нужно открутить болт.

    Сняв саблю, получаем свободный доступ к самому сайлентблоку.

  6. После этих процедур можно выбивать сами сайленблоки. Для этого используется зубило и молоток. Как правило, выбиваются они легко, но в редких случаях нужно использовать WD-40.

    Выбить детали будет проще, если их подрезать.

  7. Теперь нужно установить новую деталь. Для этого понадобится инструмент для запрессовки. Для того чтобы этот процесс прошёл без проблем, рекомендуется зачистить гнездо от ржавчины, и смазать его и деталь мыльным раствором.

    Перед запрессовкой обильно смазываем детали мыльным раствором.

Проверка

Главное не перепутайте, какой стороной нужно запрессовывать сайлентблок!

После окончания работ не должно быть люфтов, иначе подвеска доставит немало проблем в будущем.

Потом всё собирается в обратной последовательности.

Процесс самостоятельной замены сайленблоков можно освоить в течение нескольких часов. В дальнейшем это сэкономит владельцу ВАЗ-2110 немало денежных средств.

Сайлентблок передней балки 2110

Замена сайлентблоков передней балки на ВАЗ-2110: видео и фото

Одним из самых основных узлов автомобиля, отвечающих за комфорт и безопасность передвижения ВАЗ-2110, является подвеска. Не стоит думать, что главное в подвеске – это амортизаторы, колёса и пружины. Такие небольшие детали, как сайленблоки, непосредственно влияют на работу подвески. Подвеска любого современного автомобиля включает в себя множество этих резиновых деталей.

Поменять сайленблоки передней балки, как и остальные подобные элементы – это довольно проблематичный процесс. Однако если приобрести или одолжить специальные съёмники, эту процедуру можно легко выполнить своими руками.

Для чего нужны сайленблоки в передней подвеске?

Износ сайлентблока.

Некоторые начинающие водители, которых достаточно много среди владельцев ВАЗ-2110, считают, что при ремонте передней подвески нужно в первую очередь обращать внимание на рычаги, балки и амортизаторы. Такие незаметные и простые детали, как резиновые сайленблоки, зачастую просто игнорируются. Тем не менее именно данные детали обеспечивают надёжное соединение между рычагами подвески.

Хотя сайленблоки не являются расходным материалом, резина со временем, имеет тенденцию к разрушению. Жёсткие условия эксплуатации, особенно по дорогам с некачественным покрытием, тоже влияют на эти детали. Выход из строя сайленблока может спровоцировать трение между металлическими частями подвески, и выход их из строя. Поэтому важно следить за состоянием этих резиновых деталей подвески.

Диагностика сайленблоков

При сильно разбитых сайлентблоках колесо начинает задевать за подкрылок.

Для того чтобы проверить состояние сайленблоков передней балки, можно поступить двумя способами:

  1. Проще всего сделать диагностику подвески на СТО. Хотя некоторые недобросовестные мастера могут «обнаружить» множество неполадок, в надежде получить больше денег за ремонт.
  2. Опытному водителю достаточно проехать на машине несколько километров, слушая, как работает передняя подвеска, чтобы понять, в чём проблема.

Слушая работу подвески, нужно обращать внимание на следующие нюансы:

  1. Во время езды слышится характерный скрип резины. Данные звуки могут быть еле слышными, но их наличие чаще всего свидетельствует об износе сайленблоков. В этом случае автомобиль загоняется на яму, а резиновые детали проверяются на предмет разрывов или трещин. Если сайленблок с трещиной может ещё прослужить некоторое время, то порванная деталь должна быть заменена немедленно.
  2. В случае появления характерных металлических стуков в районе передней подвески, нужно как можно быстрее гнать автомобиль на смотровую яму. Как правило, это показывает на максимальный износ резиновых деталей подвески.

Если затянуть с заменой изношенных сайленблоков, может выйти из строя передняя балка, причём в ряде случаев её придётся полностью менять.

Подготовка к работе по замене сайленблоков

Для запрессовки новых сайлентблоков понадобится специальный съемник.

Перед тем, как начать процесс замены деталей подвески своими руками, нужно подготовить место и набор инструментов. В качестве места идеально подойдёт гараж с просторной смотровой ямой. Что касается инструментов, то для замены понадобится:

  1. Набор ключей и головок с трещоткой.
  2. Специальный съёмник для выпрессовки сайленблоков. Этот специфический инструмент можно или купить, или попросить у знакомых гаражных мастеров на время работы.
  3. ВД-40 или аналоги.
  4. Мыльный раствор.

Нужный съёмник довольно несложно сделать из подходящей по размеру трубы, длинного болта и шайбы.

Если съёмник достать не удастся, можно воспользоваться доступным оборудованием. В этом качестве может выступать подходящая по диаметру трубка с шайбами и тиски.

Процесс замены

Если замена резиновых деталей подвески для автовладельца в новинку, сразу может показаться, что это очень трудоёмкая и сложная процедура. Часто на этапе осмотра неопытные владельцы ВАЗ-2110 решают, что самостоятельно у них ничего не получится. На самом деле, процесс замены достаточно простой. Если сделать это однократно, в дальнейшем менять любые сайленблоки будет легко и просто.

Единственной проблемой может стать запрессовка нового сайленблока на место, так как новые детали могут быть плохо обработаны или слишком жёсткими. Особенно это касается деталей из полиуретана.

Резиновый сайлентблок.

Полиуретановые сайлентблоки.

Замена происходить по следующему алгоритму:

  1. Сначала нужно поднять переднее колесо с помощью домкрата. Домкрат желательно брать гидравлический, а под задние колёса с двух сторон подкладываются противооткатные фиксаторы. Домкрат желательно продублировать подпоркой. Так машина точно не соскочит и не придавит своего владельца.

    Снимаем колесо.

  2. Далее нужно открутить и снять колесо.
  3. В этот момент можно проверить и сайленблоки, которые находятся в рычагах. Если они болтаются, то нужно заменить и их.
  4. Выбивается передняя опора. Перед этим следует открутить гайку, которая удерживает её. Удар должен быть меткий, но не сильный.

    Откручиваем гайку сабли.

  5. После этого можно снимать верхний рычаг. Для этого нужно открутить болт.

    Сняв саблю, получаем свободный доступ к самому сайлентблоку.

  6. После этих процедур можно выбивать сами сайленблоки. Для этого используется зубило и молоток. Как правило, выбиваются они легко, но в редких случаях нужно использовать WD-40.

    Выбить детали будет проще, если их подрезать.

  7. Теперь нужно установить новую деталь. Для этого понадобится инструмент для запрессовки. Для того чтобы этот процесс прошёл без проблем, рекомендуется зачистить гнездо от ржавчины, и смазать его и деталь мыльным раствором.

    Перед запрессовкой обильно смазываем детали мыльным раствором.

Проверка

Главное не перепутайте, какой стороной нужно запрессовывать сайлентблок!

После окончания работ не должно быть люфтов, иначе подвеска доставит немало проблем в будущем. Потом всё собирается в обратной последовательности.

Процесс самостоятельной замены сайленблоков можно освоить в течение нескольких часов. В дальнейшем это сэкономит владельцу ВАЗ-2110 немало денежных средств.

2x 2110 Передний рычаг управления Impergom Рычаг поперечной устойчивости Втулка с парами G OE для продажи онлайн

Ссылка OE / OEM номер

835 C2.000 159 A5.046 159 A6.046 836 A3.000 160 A8.046, 159 A2.000 149 A1.000 160 A7.000 182 B2.000 182 A3.000, 159 A4.000 836 A5.000 835 C4.000 160 A1.000 160 A1.048, 159 A4.046 160 A2.000 160 A3.000 149 B4.000 160 A5.000, 160 185 182 159 175 835 836 930 907A 907B 167 164 932 936, 160 B6.046 160 D1.000 160 A6.000 160 A6.046 160 A1.046, 175 A1.000 182 B3.000 183 A1.000 835 A8.046 835 A7.000, 182 A4.000 182 A2.000 182 A1.000 182 A8.000 182 A7.000, 182 A6.000 188 A5.000 159 A3.000 159 B9. 000 175 А3.000, 185 А2.000 185 А3.000 186 А4.000 185 А8.000 182 В4.000, 185 А6.000 839 А5.000 182 В7.000 182 В9.000 182 А5. 000, 835 А4 .000 835 A2.046 835 A7.046 836 C4.000 836 A6.000 AR 33401, 835 A5.000 835 A2.000 835 A1.000 835 C5.000 835 A4.046, 836 A4.000 835 C1.000 159 A3.048 159 A3.046 149 C2.046, AR 30747 AR 67402 AR 67299 AR 67101 AR 67203 AR 67303 AR 67302, AR 33201 AR 33501 AR 67501 AR 33601 AR 33503 AR 38501 AR 67601, АР 38201 AR 38401 AR 67106 AR 67204 AR 32302 AR 30753 AR 30755, AR 67301 VM 07 B VM 31 B AR 66201 AR 67199 AR 32310 AR 36301, ОРИГИНАЛЬНЫЙ ИМПЕРИЙ, 149 А1.000 159 A3.000 182 B3.000 182 B4.000 182 B2.000, 159 A3.046 149 C2.046 835 C2.000 159 A5.046 159 A6.046, 159 A4.000 AR 33401 AR 33201 AR 33501 836 C4.000 836 A6.000, 159 A4.046 836 A5.000 835 C4.000 159 B9.000 175 A1.000, 159 B9.000 175 A1.000 159 A4.000 AR 33201 AR 33501 AR 67204, 160 A1 .000 160 A1.048 160 B6.046 160 A6.046 160 D1.000, 160 A1.046 159 A3.048 835 C1.000 159 A3.046 149 C2.046, 160 A3.000 149 B4.000 175 A3 .000 AR 33503 AR 38501 AR 38201, 160 A6.000 836 A4.000 160 A1.046 159 A3.048 835 C1.000, 160 B6.046 160 A6.046 160 D1. 000 160 A6.000 836 A4.000, 182 A3.000 182 A7.000 182 A8.000 AR 67601 160 A2.000, 182 A4.000 182 A3.000 182 A7.000 182 A8.000 AR 67106, 182 A5.000 182 A6.000 182 A2.000 182 A1.000 183 A1.000, 182 A6.000 182 A2.000 182 A1.000 183 A1.000 182 A4 .000, 182 B3.000 182 B4.000 182 B2.000 182 B7.000 160 A5.000, 182 B7.000 AR 32302 160 A5.000 835 A7.000 835 A5.000, 182 B9.000 185 A2. 000 839 A5.000 185 A6.000 185 A3.000, 185 A6.000 185 A3.000 186 A4.000 185 A8.000 ALFA ROMEO, 186 A4.000 185 A8.000 ОРИГИНАЛЬНЫЙ ИМПЕРИЙ ALFA ROMEO, ВАЛЮТА 2110 МОНТАЖА AR 30753 AR 30755 ИЗД. ИЗД., 30307, ​​ФАСАД ДЛЯ ИЗДЕЛИЙ, 30303 AR 3075, ФАСАД ДЛЯ ЛИЦА, 30307 AR 3075, AR 30753 ИЗДЕЛИЯ ДЛЯ КАРТИНКИ AR 30753 ИЗДЕЛИЯ ДЛЯ КАРТИНКИ, 30303 AR 3075 УСТАНОВКИ, 3030 МОНТАЖ, AR 3075, AR 3075, AR 30755, AR 30753 ИЗДЕЛИЙ, 30307, ​​AR 3075, AR 30755 835 A2.000 835 A1.000 188 A5.000 AR 32310 AR 36301 AR 33601, 835 A4.000 835 A4.046 835 A2.046 835 A7.046 159 A2.000, 835 A7.000 835 A5.000 835 A2 .000 835 A1.000 188 A5.000, 835 A7. 046 159 A2.000 159 A4.046 836 A5.000 835 C4.000, 835 C5.000 835 A8.046 AR 67204 AR 67299 182 A5.000 AR 67106, 836 A3.000 160 A8.046 835 A4.000 835 A4.046 835 A2.046, 836 C4.000 836 A6.000 835 C5.000 835 A8.046 AR 67299, AKRON-MALÒ 150831 ALFA ROMEO 60603027 BIRTH 2228 FARE SA 1910, AR 30755 AR 30747 AR 67402 AR 67101 AR 67501 AR 67203 LANCIA, AR 32310 AR 36301 182 B9.000 AR 33601 185 A2.000 839 A5.000, AR 33503 AR 38501 AR 38201 AR 38401 AR 67199 160 A7.000, AR 38401 AR 67199 160 A7.000 149 A1.000 159 A3.000 AR 32302, AR 67301 VM 31 B VM 07 B AR 66201 160 A1.000 160 A1.048, AR 67302 AR 67303 AR 67301 VM 31 B VM 07 B AR 66201 AR 33401, AR 67402 AR 67101 AR 67501 AR 67203 AR 67302 AR 67303 LANCIA, AR 67601 160 A2.000 160 A3.000 149 B4.000 175 A3.000, BEAMS BAR SWAY CONTROL ARM FAST FIX НОВЫЕ МОНТАЖЫ ПАРА КОМПЛЕКТАЦИЯ, ПОДШИПНИК ПОЛНЫЙ ОРУЖИЕ ТИХАЯ БЛОК ВЫБОР СИЛЕНТБЛОКА, ИЗМЕНЕНИЕ ВТУЛКИ ПОЛНЫЙ РЕМОНТ МОБИЛЬНЫЙ УЗЕЛ МАШИНЫ ВЕРХНЕГО НИЖНЕГО КОДА, FIAT 606030 ПРАВЫЙ НИЖНИЙ ПОДШИПНИКОВЫЕ COMPLETE ARMS сайлент-блока 28963, МОНТАЖ ПАРЫ ВТУЛКУ ИЗМЕНЕНИЕ ПОЛНЫЙ РЕМОНТ WISHBONE ДОРОЖКИ, ЗАМЕНА тротуара OffSide Suspension Переднее ПРАВЫЙ НИЖНИЙ, SELENTBLOCK SILENTBLOCK 60603027 8033989004990 AR 30753 Fiat, ВЕРХНИЙ НИЖНИЙ ЗАМЕНА тротуара OffSide подвеса, вибрирует ВИБРАЦИИ ПУЧКОВ BAR SWAY Поперечный рычаг БЫСТРО FIX NEW, Оригинальный, Wishbone

, Втулка стабилизатора автозапчастей 48815-02110 для венчика

Описание продукта:

Втулка стабилизатора: резиновое изделие, удерживающее звено стабилизатора, смягчающее давление в звене стабилизатора.

Так как это резиновый продукт, его легко повредить в течение длительного времени, а резину легче отвердеть зимой.

Это основные причины ненормального шума втулки стабилизатора.

48815-02110 Втулка стабилизатора для японского автомобиля

Элемент Втулка стабилизатора
Стандарт Качество OEM
Срок поставки , если в наличии только 4-7 рабочих дней; Производить нужно через 30-45 дней после получения депозита
Преимущества 1.Хорошая стойкость к высоким температурам
2. Высокая прочность на растяжение
3. Отличная гибкость
4. Хорошая абразивная стойкость
5. С HNBR и CR качественным костюмом для различных рынков.

Упаковка и доставка:

Наша служба:

1) На ваш запрос будет дан ответ в течение 12 часов.

2) Хорошо обученные и опытные продавцы могут ответить на ваши вопросы на английском языке.

3) Заказ будет выполнен в точном соответствии с деталями заказа и образцами.

4) Ваши деловые отношения с нами будут конфиденциальными для любой третьей стороны.

5) Хорошее послепродажное обслуживание.

Профиль компании:

Гуанчжоу Tenfront Trading Co., Ltd специализируется на японских автозапчастях,
более 1000 видов разновидностей.Все детали сделаны в Китае с хорошим качеством и конкурентоспособной ценой.
Мы предоставляем лучший сервис для наших клиентов, поэтому они высоко ценят наши продукты и услуги.

Качество может быть сравнимо с продукцией на рынках Европы и Америки, Ближнего Востока,

в Австралии, Юго-Восточной области и т. Д. И мы можем предложить конкурентоспособную цену.

Мы лучший производитель, которого вы ищете.

Вопросы и ответы:

Вопросы, которые вы можете запросить

Q1.Что ваши условия упаковки?

A: Обычно мы упаковываем наши товары в нейтральные белые коробки и коричневые коробки. Если у вас есть законно зарегистрированный патент,
мы можем упаковать товар в ваши фирменные коробки после получения ваших авторизационных писем.

Q2. Что ваши условия поставки?
A: EXW, FOB.

Q3. Как насчет вашего времени доставки?
A: Обычно это занимает от 30 до 60 дней после получения авансового платежа. Конкретное время доставки зависит
от товаров и количества вашего заказа.

Q4. Вы можете производить в соответствии с образцами?
A: Да, мы можем изготовить по вашим образцам или техническим чертежам. Мы можем построить формы и приспособления.

Q5. Какова ваша политика образца?
A: Мы можем поставить образец, если у нас есть готовые детали на складе, но клиенты должны оплатить стоимость образца и стоимость курьера.

Q6. Как вы проверить все ваши товары перед доставкой?
A: Да, у нас есть 100% тест перед поставкой.

Q7: Как вы делаете наш бизнес долгосрочным и хорошими отношениями?
А: 1.Мы держим хорошее качество и конкурентоспособные цены, чтобы обеспечить нашу пользу клиентов;
2. Мы уважаем каждого клиента как нашего друга, и мы искренне ведем дела и дружим с ним,
, независимо от того, откуда он.

. Yc153069ag для транзитных втулок V348 неподдельных авто втулка

$ 7.00 - 20,00 $ / Кусок | 10 шт. (Минимальный заказ)

Перевозка:
Служба поддержки Морские перевозки
Персонализация:

Индивидуальный логотип (Мин.Заказ: 1000 штук)

Индивидуальная упаковка (Минимальный заказ: 1000 штук)

Образцы:
,

Сайлентблоки полиуретановые для задней и передней подвески ВАЗ

Сайлентблоки служат для соединения деталей подвески и гашения колебаний, передаваемых от одного узла к другому. В самом простом случае сайлентблок представляет собой две металлические втулки, между которыми запрессована или вклеена упругая, чаще всего резиновая, втулка. При ходах подвески она деформируется и дает возможность перемещения элементов подвески.

Таким образом, обеспечение подвижности элементов подвески относительно кузова и друг друга — основная функция сайлентблоков, но далеко не единственная. Следующей функцией является обеспечение комфорта — защита кузова от вибраций и шума при работе подвески ВАЗовских автомобилей, что осуществляется за счет наличия в сайлентблоке слоя резины или полиуретана, обладающих высокой упругостью и хорошими свойствами виброшумоизоляции.

Нельзя не упомянуть и о влиянии сайлентблоков на управляемость автомобиля. Именно поэтому, в погоне за наилучшим сочетанием комфорта и управляемости, инженеры автомобилестроители применяют сайлентблоки с различными марками резины, различной формы, с композицией из разных материалов и с армированием.

Задумывались ли вы о том, что даже самый простой сайлентблок (передний или задний) будучи неисправным — например, с растрескавшейся резиновой втулкой — будет источником стуков или скрипа? Все это отразится на управляемости автомобиля — с неисправными деталями автомобиль будет склонен к уводам, может «рыскать» по траектории и вам не избежать постоянных подруливаний. Кроме того, неисправный сайлентблок является причиной поломки или преждевременного износа сопряженных деталей, а в некоторых случаях и привести к повреждению кузова.

В разговоре о сайлентблоках необходимо упомянуть и шарниры ШС. Их основная функция состоит в обеспечении подвижности элементов подвески, но при этом сам шарнир является абсолютно жестким. Если в гонке за улучшением управляемости идти по пути увеличения жесткости шарнирных соединений, то наилучший результат даст применение ШС. Именно поэтому они так популярны в спорте, особенно в асфальтовых дисциплинах. При этом жертвуют вибро- и шумозащитой, но для спортивного применения это не так существенно. Таким образом, резиновые сайлентблоки обеспечивают максимальный комфорт, а ШС — улучшенную управляемость.

Чтобы соединить преимущества этих двух вариантов, компания SS20 предлагает сайлентблоки для ВАЗ из полиуретана различной жесткости собственной разработки и производства. Желтые полиуретановые сайлентблоки по своим жесткостным характеристикам и комфорту близки к резиновым, но превосходят их в прочности и износостойкости. Сайлентблоки SS20 из красного полиуретана обладают значительно большей жесткостью, и предназначены в основном для использования в тюнинге и настройке более спортивных и заниженных подвесок.

Преимущества полиуретановых изделий:
  • ПРОЧНОСТЬ. Предел прочности полиуретана выше, чем у резины. Полиуретановые упругие элементы лучше выдерживают пиковые нагрузки, не подвергаясь разрушению. Прочность клеевого соединения полиуретана с металлическими деталями исключает отрыв или отслаивание упругого элемента от металла даже при экстремальных нагрузках.
  • НАДЁЖНОСТЬ. В области больших деформаций полиуретан дольше сохраняет свою упругость, чем резина. Поэтому полиуретановые упругие элементы сохраняют работоспособность в большом диапазоне нагрузок.
  • ДОЛГОВЕЧНОСТЬ. Остаточные деформации полиуретана ниже, чем у резины. Благодаря этому полиуретановые упругие элементы дольше сохраняют свою работоспособность.
  • Высокая износостойкость, влаго-, бензо-, и маслостойкость обеспечивают длительный срок службы полиуретановых упругих элементов (в том числе и сайлентблоков) в самых неблагоприятных дорожных и климатических условиях.

Кроме того, ресурс полиуретановых деталей выше резиновых в 4-5 раз и более.

Сравнение основных характеристик полиуретана и резины*
Физико-механический показательРазмерностьПолиуретанРезина**
Твёрдость по Шору, шкала АУсл. ед.69 - 7065 - 75
Модуль упругости — 100%МПа2912
Модуль упругости — 300%МПа67--
Предел прочности при разрыве кг/см²312115
Удлинение при разрыве%523300
Сопротивление раздирукг/см²5820
Усадка (относительная остаточная деформация сжатия)%33,535-40
Изменение массы при воздействии агрессивной среды СЖР-7%+5,98+35
Температурный предел хрупкости-77-70
Коэффициент морозостойкости по эластическому восстановлению после сжатия, при -50°C 0,450,2
Сравнение основных характеристик жёлтого и красного полиуретана*.
ХарактеристикиЖелтый полиуретанКрасный полиуретан
Твёрдость по Шору, шкала А6580
Ударная вязкость, %4056
Модуль упругости, кг/см²2540
Предел прочности при растяжении, кг/см²350400
Удлинение при разрыве, %550500
Прочность на раздир, кг/см5060
Абразивная стойкость, шабер Н221020

* — данные взяты из разных источников, свойства полиуретановых изделий SS20 соответствуют данным из обеих таблиц;
** — марка резины ИТП-1357 используется в автопромышленности для изготовления сайлентблоков.

Для спортивной (более жесткой) подвески рекомендуем использовать красные полиуретановые сайлентблоки

Полиуретановые автомобильные детали (в том числе и предлагаемые нами сайлентблоки для автомобилей ВАЗ) выгодно отличаются от резиновых в жестких климатических и дорожных условиях России. Посмотреть весь ассортимент полиуретановых изделий можно в каталоге.

2110-2914054 Шарнир рычага задней балки SS20.72.26.000-02

Сайлентблоки ВАЗ передней и задней подвески

Сайлентблоки в автомобилях ВАЗ, и не только в них, это шарнирные элементы, которые обеспечивают возможность взаимных перемещений колес и кузова автомобиля при движении.


Применяемость

  • ВАЗ 2101-2107
  • ВАЗ 2108-2199
  • ВАЗ 2110-2112
  • ВАЗ 2113-2115
  • ВАЗ 1117-1119 (Лада Калина)
  • ВАЗ 2170-2172 (Лада Приора)
  • ВАЗ 2121-2131
  • Chevrolet Niva

Преимущества использования сайлентблоков SS20 в автомобилях ВАЗ

  • ресурс в 4-5 раз выше резиновых;
  • имеют длительный срок службы в неблагоприятных дорожных и климатических условиях;
  • улучшают контроль над управляемостью за счёт уменьшения времени ответной реакции автомобиля на действия водителя;
  • в отличие от резиновых лучше выдерживают пиковые нагрузки, не подвергаясь разрушению;
  • сохраняют эластичность при температуре до –40˚С;
  • обладают прогрессивной характеристикой на сжатие;
  • не производят химических выделений.

Гарантия
2 года
Описание
Сайлентблоки
служат для соединения деталей подвески и гашения колебаний, передаваемых от одного узла к другому. В самом простом случае сайлентблок представляет собой две металлические втулки, между которыми запрессована или вклеена упругая, чаще всего резиновая, втулка. При ходах подвески она деформируется и дает возможность перемещения элементов подвески.
Таким образом, обеспечение подвижности элементов подвески относительно кузова и друг друга — основная функция сайлентблоков, но далеко не единственная. Следующей функцией является обеспечение комфорта — защита кузова от вибраций и шума при работе подвески ВАЗовских автомобилей, что осуществляется за счет наличия в сайлентблоке слоя резины или полиуретана, обладающих высокой упругостью и хорошими свойствами виброшумоизоляции.
Нельзя не упомянуть и о влиянии сайлентблоков на управляемость автомобиля. Именно поэтому, в погоне за наилучшим сочетанием комфорта и управляемости, инженеры автомобилестроители применяют сайлентблоки с различными марками резины, различной формы, с композицией из разных материалов и с армированием.
Задумывались ли вы о том, что даже самый простой сайлентблок (передний или задний) будучи неисправным — например, с растрескавшейся резиновой втулкой — будет источником стуков или скрипа? Все это отразится на управляемости автомобиля — с неисправными деталями автомобиль будет склонен к уводам, может «рыскать» по траектории и вам не избежать постоянных подруливаний. Кроме того, неисправный сайлентблок является причиной поломки или преждевременного износа сопряженных деталей, а в некоторых случаях и привести к повреждению кузова.
В разговоре о сайлентблоках необходимо упомянуть и шарниры ШС. Их основная функция состоит в обеспечении подвижности элементов подвески, но при этом сам шарнир является абсолютно жестким. Если в гонке за улучшением управляемости идти по пути увеличения жесткости шарнирных соединений, то наилучший результат даст применение ШС. Именно поэтому они так популярны в спорте, особенно в асфальтовых дисциплинах. При этом жертвуют вибро- и шумозащитой, но для спортивного применения это не так существенно. Таким образом, резиновые сайлентблоки обеспечивают максимальный комфорт, а ШС — улучшенную управляемость.
Чтобы соединить преимущества этих двух вариантов, компания SS20 предлагает сайлентблоки для ВАЗ из полиуретана различной жесткости собственной разработки и производства. Желтые полиуретановые сайлентблоки по своим жесткостным характеристикам и комфорту близки к резиновым, но превосходят их в прочности и износостойкости. Сайлентблоки SS20 из красного полиуретана обладают значительно большей жесткостью, и предназначены в основном для использования в тюнинге и настройке более спортивных и заниженных подвесок.
Преимущества полиуретановых изделий:

  • ПРОЧНОСТЬ. Предел прочности полиуретана выше, чем у резины. Полиуретановые упругие элементы лучше выдерживают пиковые нагрузки, не подвергаясь разрушению. Прочность клеевого соединения полиуретана с металлическими деталями исключает отрыв или отслаивание упругого элемента от металла даже при экстремальных нагрузках.
  • НАДЁЖНОСТЬ. В области больших деформаций полиуретан дольше сохраняет свою упругость, чем резина. Поэтому полиуретановые упругие элементы сохраняют работоспособность в большом диапазоне нагрузок.
  • ДОЛГОВЕЧНОСТЬ. Остаточные деформации полиуретана ниже, чем у резины. Благодаря этому полиуретановые упругие элементы дольше сохраняют свою работоспособность.
  • Высокая износостойкость, влаго-, бензо-, и маслостойкость обеспечивают длительный срок службы полиуретановых упругих элементов (в том числе и сайлентблоков) в самых неблагоприятных дорожных и климатических условиях.

Кроме того, ресурс полиуретановых деталей выше резиновых в 4-5 раз и более.
Сравнение основных характеристик полиуретана и резины*

Физико-механический показатель Размерность Полиуретан Резина**
Твёрдость по Шору, шкала А Усл. ед. 69 - 70 65 - 75
Модуль упругости — 100% МПа 29 12
Модуль упругости — 300% МПа 67 --
Предел прочности при разрыве кг/см² 312 115
Удлинение при разрыве % 523 300
Сопротивление раздиру кг/см² 58 20
Усадка (относительная остаточная деформация сжатия) % 33,5 35-40
Изменение массы при воздействии агрессивной среды СЖР-7 % +5,98 +35
Температурный предел хрупкости -77 -70
Коэффициент морозостойкости по эластическому восстановлению после сжатия, при -50°C 0,45 0,2

Сравнение основных характеристик жёлтого и красного полиуретана*.

Характеристики Желтый полиуретан Красный полиуретан
Твёрдость по Шору, шкала А 65 80
Ударная вязкость, % 40 56
Модуль упругости, кг/см² 25 40
Предел прочности при растяжении, кг/см² 350 400
Удлинение при разрыве, % 550 500
Прочность на раздир, кг/см 50 60
Абразивная стойкость, шабер Н22 10 20

* — данные взяты из разных источников, свойства полиуретановых изделий SS20 соответствуют данным из обеих таблиц;
** — марка резины ИТП-1357 используется в автопромышленности для изготовления сайлентблоков.
Для спортивной (более жесткой) подвески рекомендуем использовать красные полиуретановые сайлентблоки

Полиуретановые автомобильные детали (в том числе и предлагаемые нами сайлентблоки для автомобилей ВАЗ) выгодно отличаются от резиновых в жестких климатических и дорожных условиях России. Посмотреть весь ассортимент полиуретановых изделий можно в каталоге.

Модификации

SS70101 2108-010-2915446-01 Втулка амортизатора задней подвески SS20.72.01.000-04
ВАЗ 2108, ВАЗ 2109, ВАЗ 21099, ВАЗ 2113, ВАЗ 2114, ВАЗ 2115, ВАЗ 2110, ВАЗ 2111, ВАЗ 2112, ВАЗ 1117, ВАЗ 1118, ВАЗ 1119, ВАЗ 2170, ВАЗ 2171, ВАЗ 2172, ВАЗ 2190, ВАЗ 2191, ВАЗ 2192, ВАЗ 2194, Datsun on-DO, Datsun mi-DO, 2108-2915446, 2108-2915446-01, 21080-2915446-01
Гарантия 2 года
В комплекте 2 штуки

SS70102 2108-010-2904050 Подушка переднего шарнира SS20.72.07.000-02
ВАЗ 2108, ВАЗ 2109, ВАЗ 21099, ВАЗ 2113, ВАЗ 2114, ВАЗ 2115, ВАЗ 2110, ВАЗ 2111, ВАЗ 2112, ВАЗ 1117, ВАЗ 1118, ВАЗ 1119, ВАЗ 2170, ВАЗ 2171, ВАЗ 2172, ВАЗ 2190, ВАЗ 2191, ВАЗ 2192, ВАЗ 2194, Datsun on-DO, Datsun mi-DO, 2108-2904050, 21080-2904050-00
Гарантия 2 года
В комплекте 2 штуки

SS70103 2108-010-2904040 Шарнир нижнего рычага передней подвески SS20.72.06.000-02
ВАЗ 2108, ВАЗ 2109, ВАЗ 21099, ВАЗ 2113, ВАЗ 2114, ВАЗ 2115, ВАЗ 2110, ВАЗ 2111, ВАЗ 2112, ВАЗ 1117, ВАЗ 1118, ВАЗ 1119, ВАЗ 2170, ВАЗ 2171, ВАЗ 2172, ВАЗ 2190, ВАЗ 2191, ВАЗ 2192, ВАЗ 2194, Datsun on-DO, Datsun mi-DO, 2108-2904040, 21080-2904040, 21080-2904040-00
Гарантия 2 года
В комплекте 2 штуки

SS70104 2108-010-2904046 Шарнир растяжки задний SS20.72.05.000-02
ВАЗ 2108, ВАЗ 2109, ВАЗ 21099, ВАЗ 2113, ВАЗ 2114, ВАЗ 2115, ВАЗ 2110, ВАЗ 2111, ВАЗ 2112, ВАЗ 1117, ВАЗ 1118, ВАЗ 1119, ВАЗ 2170, ВАЗ 2171, ВАЗ 2172, ВАЗ 2190, ВАЗ 2191, ВАЗ 2192, ВАЗ 2194, Datsun on-DO, Datsun mi-DO, 2108-2904046, 21080-2904046, 21080-2904046-00
Гарантия 2 года
В комплекте 4 штуки

SS70105 2110-2915450 Подушка амортизатора задней подвески SS20.72.10.001-02
ВАЗ 2108, ВАЗ 2109, ВАЗ 21099, ВАЗ 2113, ВАЗ 2114, ВАЗ 2115, ВАЗ 2110, ВАЗ 2111, ВАЗ 2112, ВАЗ 1117, ВАЗ 1118, ВАЗ 1119, ВАЗ 2170, ВАЗ 2171, ВАЗ 2172, ВАЗ 2190, ВАЗ 2191, ВАЗ 2192, ВАЗ 2194, Datsun on-DO, Datsun mi-DO, 2110-2915450
Гарантия 2 года
В комплекте 4 штуки

SS70106 2108-010-3403080-82 Опора рулевого механизма SS20.72.08.001-02
ВАЗ 2108, ВАЗ 2109, ВАЗ 21099, ВАЗ 2113, ВАЗ 2114, ВАЗ 2115, ВАЗ 2110 с РМ старого образца, ВАЗ 2111 с РМ старого образца, ВАЗ 2112 с РМ старого образца, 2108-3403080-82
Гарантия 2 года
В комплекте 2 штуки

SS70107 2108-2906040 Подушка штанги стабилизатора SS20.72.04.001-02
ВАЗ 2108, ВАЗ 2109, ВАЗ 21099, ВАЗ 2113, ВАЗ 2114, ВАЗ 2115, 2108-2906040, 21080-2906040-00
Гарантия 2 года
В комплекте 2 штуки

SS70108 2110-2906040 Подушка штанги стабилизатора SS20.72.25.001-02
ВАЗ 2110, ВАЗ 2111, ВАЗ 2112, 2110-2906040, 21100-2906040-00
Гарантия 2 года
В комплекте 2 штуки

SS70109 1118-2906040 Подушка штанги стабилизатора SS20.72.11.001-02
ВАЗ 1117, ВАЗ 1118, ВАЗ 1119, ВАЗ 2170, ВАЗ 2171, ВАЗ 2172, 1118-2906040, 11180-2906040-00
Гарантия 2 года
В комплекте 2 штуки

SS70110 2108-2914054 Шарнир рычага задней балки SS20.72.02.000-02
ВАЗ 2108, ВАЗ 2109, ВАЗ 21099, ВАЗ 2113, ВАЗ 2114, ВАЗ 2115, 2108-2914054
Гарантия 2 года
В комплекте 2 штуки

SS70111 2110-2914054 Шарнир рычага задней балки SS20.72.26.000-02
ВАЗ 2110, ВАЗ 2111, ВАЗ 2112, ВАЗ 1117, ВАЗ 1118, ВАЗ 1119, ВАЗ 2170, ВАЗ 2171, ВАЗ 2172, ВАЗ 2190, ВАЗ 2191, ВАЗ 2192, ВАЗ 2194, Datsun on-DO, Datsun mi-DO, 2110-2914054, 21100-2914054-00
Гарантия 2 года
В комплекте 2 штуки

SS70122 2101-2906231 Подушка амортизатора конусная (4)
ВАЗ 2101, ВАЗ 2102, ВАЗ 2103, ВАЗ 2104, ВАЗ 2105, ВАЗ 2106, ВАЗ 2107, ВАЗ 2121, ВАЗ 2131, Chevrolet Niva, 2101-2906231
Гарантия 2 года
В комплекте 4 штуки

SS70123 2101-2906040 Подушка поперечного стабилизатора (2)
ВАЗ 2101, ВАЗ 2102, ВАЗ 2103, ВАЗ 2104, ВАЗ 2105, ВАЗ 2106, ВАЗ 2107, 2101-2906040
Гарантия 2 года
В комплекте 2 штуки

SS70124 2101-2919108 Втулка реактивной тяги (малая) (6)
ВАЗ 2101, ВАЗ 2102, ВАЗ 2103, ВАЗ 2104, ВАЗ 2105, ВАЗ 2106, ВАЗ 2107, ВАЗ 2121, ВАЗ 21214, ВАЗ 2131, Chevrolet Niva, 2101-2919108
Гарантия 2 года
В комплекте 6 штук

SS70125 2101-2919042 Втулка реактивной тяги (большая) (4)
ВАЗ 2101, ВАЗ 2102, ВАЗ 2103, ВАЗ 2104, ВАЗ 2105, ВАЗ 2106, ВАЗ 2107, ВАЗ 2121, ВАЗ 21214, ВАЗ 2131, Chevrolet Niva, 2101-2919042
Гарантия 2 года
В комплекте 4 штуки

SS70126 2101-2904180 Шарнир верхнего рычага (4)
ВАЗ 2101, ВАЗ 2102, ВАЗ 2103, ВАЗ 2104, ВАЗ 2105, ВАЗ 2106, ВАЗ 2107, 2101-2904180
Гарантия 2 года
В комплекте 4 штуки

SS70127 2101(2121)-2904040 Шарнир нижнего рычага (4)
ВАЗ 2101, ВАЗ 2102, ВАЗ 2103, ВАЗ 2104, ВАЗ 2105, ВАЗ 2106, ВАЗ 2107, ВАЗ 2121 шарнир верхнего рычага, ВАЗ 2131 шарнир верхнего рычага, ВАЗ 2123 шарнир верхнего рычага, 2101-2904040
Гарантия 2 года
В комплекте 4 штуки

SS70128 2121-2906040 Подушка стабилизатора концевая (2)
ВАЗ 2121, ВАЗ 21214, ВАЗ 2131, 2121-2906040
Гарантия 2 года
В комплекте 2 штуки

SS70129 2121-2904040 Шарнир рычага (4)
Chevrolet Niva, ВАЗ 2121, ВАЗ 21214, ВАЗ 2131, 2121-2904040
Гарантия 2 года
В комплекте 4 штуки

SS70130 2121-2906046 Подушка стабилизатора центральная (2)
ВАЗ 2121, ВАЗ 21214, ВАЗ 2131, 2121-2906046
Гарантия 2 года
В комплекте 2 штуки

SS70131 2123-2906040 Подушка поперечного стабилизатора (4)
Chevrolet Niva, 2123-2906040
Гарантия 2 года
В комплекте 4 штуки

SS70132 2123-2906046 Подушка стабилизатора центральная (2)
Chevrolet Niva, 2123-2906046
Гарантия 2 года
В комплекте 2 штуки

SS60101 Сайлентблок амортизатора
ВАЗ 2101, ВАЗ 2102, ВАЗ 2103, ВАЗ 2104, ВАЗ 2105, ВАЗ 2106, ВАЗ 2107, ВАЗ 2121, ВАЗ 2123, для передних амортизаторов SS20, 2101-2905448
Гарантия 1 год
В комплекте 2 штуки

SS70133 2190-2906040 Подушка штанги стабилизатора
ВАЗ 2190, 2190-2906040, 21900-2906040-00
Гарантия 2 года
В комплекте 2 штуки

SS70134 2192-2906040 Подушка штанги стабилизатора SS20.72.11.001-04
ВАЗ 2192, 2192-2906040
Гарантия 2 года
В комплекте 2 штуки

SS70135 2180-8450006748 Подушка штанги переднего стабилизатора поперечной устойчивости SS20.72.42.001 для LADA Vesta
ЛАДА Веста, 8450006748
Гарантия 1 год
В комплекте 2 штуки

Замена сайлентблоков передних рычагов ВАЗ 2111. Замена сайлентблоков передней балки ваз 2110-12, Приора

Комментарии к теме Замена сайлентблоков передних рычагов ВАЗ 2111

Багдат

Хорошый ролик полезный я менял балку целиком с сайленблоками. Нужно посмотреть а то колесо чуть наза уходит. Ромашки менял. Сайленблоки задней балки и стоек тоже менял, в целом не сложно но время нужно. У моего другана на 2111 и без сайлентблока передних рычагов полно чем заниматься Ж))

Ференц

Спасибо за ролик, мне это очень помогло. Вы обещали показать как поменять ступечный подшипник.

Borre

После этого надо сход развал делать?

Simba

СТОЛЬКО ... ПРИ ЗАМЕНЕ ЦЕЛЫХ САЛЕНБЛОКОВ НА ЦЕЛЫЕ=) По сайлентблоку передних рычагов все обговорили!

Аму Трибоцкий

Какая нафиг передняя балка? Вы там что курите?

Криштиану

Много лишних слов

Tavis

Спасибо все понятно. Но у меня почему то он ни вкакую не хочет заходить туда. Вздувается и не заходит

Nicolai

всем то не угодишь!! Мне друг сказал с сайлентблоком передних рычагов на 2111 пока все в ажуре,

Лии

делаю все так. но он больше с каждой стороны на 7мм сжался в летающую тарелку

Maarouf

Спасибо за видео!!!

Индустрия

Спасибо за наглядность и последовательность действий!

Жанибек

есть разница в размере ваз 10ка или 08 😉 Желательно в деталях по сайлентблоку передних рычагов объяснил бы…

Салех

всё понятно,Ясам поменял на передних рычагах сайлентблоки -так же запресовывал их одним пальцем, ромашки, снемал стойки менял пружины,опорники, буферы,пыльники,- а вот передняя балка бала прослаблена(откру чены болты) все4,хорошо что руки И-до неё дошли -протянул всё. от меня палец в верх.

Солтан

при первой возможности сниму это видео

Костеневич Нептун

А что за сволочь дизлайк поставил? У приятеля на 2111 с сайлентблоком передних рычагов до сих пор все норм 😉

Нодир Печенюк

автору спасиба видос супер все понятно!!! у меня ниссан 1990 года видео по нему нет

Sheldon

Шланги тормозные стоят не правильно, развальщик не очень, правая сторона рулевых не правильно зажата. Не все тяги пружинят (уже давно на этом говне ни кто не ездит) Прокрутом можно определить их состояние на сухость рип и плавный ход, дергать ее в верх вниз не всегда показательно, домкратим и за колесо руками право лево или на стоячей рукой за колесо. Упора ограничения на левом рычаге нет, можешь повредить пыльник на вывороте, и достать болтами твоего развальщика. Я не ставлю тебе дизлайков, просто дополняю. И то быстро, уверен еще много можно добавить. Гнут сошки маятника и рулевого, а не тяги, хочу фото этого редкого для меня случая. Первый показатель это не тянет, у положение руля. Маятники и на подшипниках есть, звучат еще больше втулочных.дак как отличить? Что бы не путать? Надо дополнять) еще роликами. Удачи

Сурен

Какие впечатления от амортизаторов Kyb? Не стучат на отбой?

Laszlo

Периодические проблемы с сайлентблоком передних рычагов это еще что 😉 Всё яснее ясного

Владка

Шаровые можно открутить и подшипник регулируют немного по-другому желательно динаметричемеим ключём,ну это а идиале, а так всё понятно.Респект!!!

Dylan

обязательно надо сказать,что затягивать на опущенной машине.иначе втулка работает на разрыв.я заехал в три сервиса,включаю Тойота СТО и все меняют на подъемнике.естествен но отказался и поехал сам менять.

Похожие видео по ремонту

Ремонт кардана, устранение вибрации на отечественном авто. Вклейка лобового стекла ВАЗ 2110 Замена масла ЛАДА гранта,калина.А налог сливной пробки поддона двигателя Меняем масло, какое масло выбрать в авто ваз 2112 Замена фильтра салона ВАЗ 2111 2005 года выпуска Демонтаж целого зеркального элемента ваз 2110 2 И опять АВТОВАЗ 2110. Замена Порогов, арок, сварочные работы, обработка Утечка тормозной жидкости ЗАМЕНА ПЕРЕДНИХ ТОРМОЗНЫХ ДИСКОВ ВАЗ Уплотнители со смещением на двери ВАЗ 2112, Приора, ПриоДвенарь(делаем авто тише, шум в салоне ВАЗ) Замена ШРУСА гранаты на ваз 2114, ваз 2115 и т д

Сайлентблок кронштейна растяжки 2108-099, передней балки 2110-2112

Производитель Балаково
Страна происхождения РОССИЯ
Номер по каталогу 2108-2904050
Номер производителя 2108-2904050

Категории: ВАЗ

Сайлентблок кронштейна растяжки 2108-099, передней балки 2110-2112 отзывы

Оставьте отзыв об этом товаре первым!

Обращаем внимание, указание ТОВАРНЫХ ЗНАКОВ (наименований марок автомобилей) направлено на информирование покупателей о применимости запасной части к той или иной марке автомобиля, то есть на потребительские свойства товара. Данная информация не вводит потребителя в заблуждение относительно предлагаемых к продаже запасных частей для автомобилей и его производителе, не нарушает права правообладателей указанных товарных знаков. Требование предоставлять покупателю необходимую и достоверную информацию о товаре, предлагаемом к продаже, обеспечивающую возможность их правильного выбора возложено на продавца (изготовителя) Законом «О защите прав потребителей», ст. 495 ГК РФ.

Болт задней балки 2110 размер

Здравствуйте уважаемые, читатели блога RtiIvaz.ru. Сегодня я хочу поговорить про сайлентблок задней балки -простоту замены на автомобилях ваз при ремонте своими руками.

Сайлентблоки и различные детали подвески от завода достаточно надежны, служат долго. Обычно их долголетие зависит от того, как вы эксплуатируете автомобиль, обслуживаете и как правило хватает на 80-90 тыс км пробега. Салентблок что это узнайте тут.

Давайте для начала рассмотрим признаки износа сайлентблоков задней балки. При движении на поворотах машина теряет устойчивость, происходит неравномерный износ покрышек. Либо при движении по ямам и кочкам на дороге появляются удары по кузову и неприятный скрип в задней части автомобиля.

Неприятные звуки при езде могут возникать и при других неисправностях. Стуки могут исходить в одном месте, а слышны в другом, особенно по ходу они слышны в задней части кузова. Поэтому прежде нужна тщательная диагностика всей задней и передней подвески: предстоит вам проверить стойки, подшипники, опоры, глушитель и.т.д.

Окончательно убедившись, что именно резиновые сайлентблоки предельно изношены, приступаем к их замене. Благо по сравнению с иномарками, замена сайлентблока задней подвески автомобилей ваз «девяток» или «десяток» отличается своей простотой и дешевизной.

Для начало купим резиновые втулки «грибки», то есть сайлентблоки на заднею балку в автомагазине. Для автомобилей ваз 2108; 2109; 21099 надо приобрести сайлентблоки с конструкторским номером ваз 2108-2914054-10, а для автомобилей ваз 2110; 2112; 2114; 2115 предписан конструкторский номер ваз 2110-2914054.

Данные сайлентблоки данных автомобилей отличить друг от друга сложно, потому что очень похожи, но разные по наружному диаметру (см. разницу на фото). Вы не сможете установить сайлентблоки от «девятки» ваз 2109 на балку «десятки» ваз 2110, так как будут болтаться. А вот от «десятки» резиновую втулку, если постараться можно запрессовать в балку «девятки».

Пошаговая замена сайлентблоков задней балки на автомашинах ваз 2108; 2109; 21099; 2110; 2112; 2114; 2115:

  • 1. Замену сайлентблоков следует проводить на эстакаде, смотровой яме или подъемнике, установив машину доступным вам способом.
  • 2. Снимем заднее колесо, чтобы не мешало.


  • 3. С левой стороны отсоединим от балки тягу регулятора давления задних тормозов (см. на фото номер-1.) с правой стороны убираем в сторону трос ручника (см. на фото номер-2.)
  • 4. Ключом на «19» отворачиваем гайку с болта крепления задней балки кронштейну (см. на фото номер-3)
  • 5. Страгиваем болт крепления молотком, а затем выбиваем воротком (см. на фото номер-4.)
  • 6. Далее поднимаем кузов автомобиля домкратом и отводим проушину балки вниз
  • 7. Между кузовом и балкой вставляем деревянный брусок
  • 8. Молотком с помощью выколотки выбиваем резиновые втулки задней балки
  • 9. Почистив посадочное гнездо от грязи, ржавчины, обильно смазываем густым мыльным раствором и саму резиновую втулку тоже смажем
  • 10. С помощью приспособления запрессовываем втулку. Если нет приспособления, то забиваем молотком, ударяя по шляпе вставленного любого подходящего болта с шайбой большего диаметра, но чтобы шайба плотно прилегало к резине
  • 11. Затем деревянный брусок вытаскиваем
  • 12. Домкратом поднимаем балку и одеваем свой родной болт крепления, далее наживляем гайку
  • 13. Поставив заднее колесо, опускаем автомобиль
  • 14. Открываем дверь багажника, затем усаживаясь на бампер, всем своим весом прижимаем насколько можно зад автомобиля
  • 15. Затягиваем болты крепления сайлентблока до упора

Собственно работа сама по себе вроде не сложная, если есть съёмник. А если его нет, что делать тогда? Поэтому пишу для тех, кто ремонтирует своими руками автомобиль ваз. Не надо усложнять задачу, если у вас нет спецсъёмника. Прислушайтесь к советам автослесарей: не морочить голову и выбивать –забивать сайлентблоки на балках молотком.

Конструкторский номер шарнира крепления рычага задней подвески: ваз 2110-2914054

Конструкторский номер шарнира крепления рычага задней подвески: ваз 2108-2914054-10

Конструкторский номер шарнира крепления рычага задней подвески: ваз 1111-2914054



Т.к. вы неавторизованы на сайте. Войти.

Т.к. тема является архивной.

Для моделей 08, 09 и 099 нужно приобретать указанные элементы со следующим каталожным номером: 2108-2914054. Для версий 10, 12, 14, 15 подходят сайлентблоки с номером 2110-2914054. Отличие этих конструкций в наружном диаметре (разница можно увидеть на рис. No 1а). В случае попытки поставить на балку > сайлентблоки от десятой модели или наоборот, вас ожидает малоприятный сюрприз.

Устройство, назначение и порядок замены задней балки в автомобиле ВАЗ 2110

Штатная задняя балка ВАЗ 2110, как элемент подвески автомобиля, служит для придания транспортному средству поперечной устойчивости и является таким приспособлением, на котором крепятся все остальные элементы кормовой подвески.

Устройство задней балки

Металлическая задняя балка, фото которой представлено на нашем ресурсе, конструктивно представлена 2 рычагами продольного типа и элементами соединения, которые соединены методом сварки через компоненты усиления. На корме изделия расположены специальные держатели с отверстиями для монтажа амортизаторных элементов. Также там конструктивно исполнены фланцы с отверстиями под крепеж осей задней колесной пары совместно с кожухами систем кормовых тормозов.

В передней части балки заднего моста ВАЗ 2110 расположены рычаги с приваренными втулками, в которых методом запрессовки установлены шарниры резинометаллического типа. Через них проходят крепления задней балки, которые соединяют рычажную часть кормовой подвески к держателям штампованно-сварного типа. Те, в свою очередь, монтируются болтами приварного вида к кузовным лонжеронам.

Пружинные элементы подвески упираются одной плоскостью на подставку амортизаторной стойки, а другим, через прокладку-изолятор резинового типа в сварную опору потайной арки кузовного оперения. Амортизаторная стойка балки задней подвески ВАЗ 2110 представляет собой гидравлическую систему телескопического действия двухстороннего принципа действия.

Она через крепеж в виде болтового соединения сочленяется с держателем рычага продольного типа кормовой подвески. Верхний крепеж стойки изготовлен в виде штыревого соединения, при этом крепление штока к верхней опоре сделано через подушки резинового типа и шайбу опоры.

Заводская задняя балка «десятки», размеры которой отличаются от параметров аналогичных изделий, имеет номенклатурный номер 2110-2914008, в то время как балка «восьмерки» имеет номер 2108-2914008-10 по каталогу.

Снятие и установка задней балки и ее элементов

Если в ходе эксплуатации транспортного средства лопнула балка задней подвески ВАЗ 2110, то в перспективе требуется ее замена. Конечно, в качестве временного вспомогательного средства можно ее восстановить методом сварки. Но это делается исключительно для того, чтобы доехать до места техобслуживания, где ее необходимо заменить.

Эксплуатация автомобиля со сварной балкой задней подвески ВАЗ 2110 не только создает аварийно-опасную ситуацию на дороге, но и приводит к нарушению устойчивости автомобиля и ускоренному износу автошин транспортного средства. Рыночная стоимость задней балки достаточно высока, но ее замена в данном случае просто необходима.

Замену такого изделия, как задняя балка, купить которую можно в любом специализированном автомобильном магазине, проводим по следующему сценарию:

  1. Устанавливаем транспортное средство на электрический подъемник или специальную ремонтную яму.
  2. Демонтируем колодки тормозов с задних колес и освобождаем тросики ручного тормоза от задней балки и держателей.
  3. Снимаем трубки тормозов от задних цилиндров, а шланги от кормовой балки.
  4. Демонтируем крепеж регулятора давления приводного типа от кормовой балки.
  5. Снимаем 4 болта крепежа оси ступицы к кормовой балке с помощью гаечного ключа на «17».
  6. Демонтируем ступичную ось совместно с кожухом механизма тормозов.
  7. Убрав скобу крепежа, демонтируем трубку тормозной системы.
  8. По возникновении надобности ступичную ось и кожух механизма тормозов рассоединяем, при этом освободив 2 винта фигурной отверткой.
  9. Открепляем низовой крепеж амортизаторов от задней балки.
  10. Снимаем крепеж балки задней подвески к держателям.
  11. Устанавливаем заднюю балку на землю.
  12. Сняв крепеж, демонтируем изделие.
  13. Снимаем крепеж держателя к кузовным изделиям и демонтируем кронштейн.
  14. Установка компонента задней подвески проводится в обратном порядке.
  15. Крепеж задней балки и нижней части амортизаторных стоек завершаем при транспортном средстве, установленном на площадке.
  16. Завершаем работу прокачиванием тормозной системы.

На «десятку» в специализированных автомобильных магазинах всегда в реализации находится стабилизатор задней балки, который применяется специалистами в качестве компонента тюнинга для этой модели. Этот элемент представлен в виде прута из стали с крепежом к кормовой балке и внешне похож на стабилизатор устойчивости в поперечнике, устанавливаемый на фронтальной подвеске.

Принципиальная разница состоит в том, что при установке системы на передних колесах и преодолении препятствий задней колесной парой стабилизатор создает момент скручивания, а стабилизатор задней балки придает кормовой подвеске больше жесткости, при этом она будет создавать меньший момент кручения.

Монтаж этого изделия придает автомобилю следующие свойства:

  • снижает угол крена кузовной части транспортного средства при проведении поворотов;
  • увеличивает скорость преодоления поворотных фигур;
  • улучшается взаимодействие задней подвески с рулевым механизмом.

Такое изделие, как сайлентблок задней балки, подлежит замене при условии, если в районе кормовой подвески прослушиваются определенные стуки или поскрипывание резинотехнических изделий, которыми оборудуются компоненты ходового механизма. При совершении поступательного движения или выполнении поворотных фигур транспортное средство недостаточно устойчиво в районе кормы. При этом наблюдается неравномерное изнашивание протектора на задних колесах.

Порядок замены сайлентблока:

  1. Отвинчиваем крепежные гайки с болтов кормовой балки, демонтируем скобу-фиксатор слева и разъединяем регуляторную тормозную тягу.
  2. Освобождаем болт из технологического отверстия и несколько приподнимаем транспортное средство на домкрате, проушину балки отводим в нижнюю плоскость. Применяем брус из дерева в качестве прокладки между кузовной поверхностью и задней балкой.
  3. Выпрессовываем сайлентблок задней балки с помощью съемника или выколотки.
  4. Производим смазку рабочих поверхностей изделия и проушины раствором, облегчающим его монтаж, и запрессовываем изделие на место.
  5. Вытаскиваем брус, другим домкратом проводим соосную установку проушины балки задней установки с кронштейном и закрепить крепежом.
  6. Затяжку крепежа кормовой балки проводим на авто, снятом с подъемных механизмов.

Подбор сайлентблоков задней балки ВАЗ 2110 осуществляется в соответствии с номенклатурным номером 2110-2914054. Принципиальная разница этих изделий от аналогичных запчастей ВАЗовского модельного ряда состоит в размере наружных диаметров изделия. Штатный сайлентблок задней балки, замену которого можно произвести на электрическом подъемнике либо на эстакаде или водительской яме, приобретают в автомагазинах по соответствующему коду номенклатурного каталога.

Задняя балка и ВАЗ 2110

Балки, как задняя, так и передняя, являются важными звеньями в автомобиле. Задняя балка ВАЗ 2110 сделана из двух расположенных продольно рычагов, соединенных между собой. Крепеж производится при помощи усилителей, которые были приварены друг к другу.

Строение балки

С внутренней стороны к рычагам подвески прикрепляются кронштейны со специальными отверстиями, необходимыми для установки амортизаторов. Также там располагаются фланцы, скрепленные при помощи болтов с осью задних колес и щитами, находящимися на тормозном механизме. С лицевой стороны к рычагам подвески прикрепляются втулки. Они вставляются в шарниры, сделанные из специального резинометаллического материала.

Сквозь них проходят болты, соединяющие рычаги подвески вместе со штампованно-сварными кронштейнами. Они, в свою очередь, прикреплены болтами, заваренными в лонжероне автомобиля. Пружины задней балки ВАЗ 2110 располагаются таким образом, что первое окончание упирается в углубление амортизатора, а второе проходит сквозь специальную прокладку непосредственно в опорную область, прикрепленную к изнаночной стороне арки на кузове автомобиля.

Прокладка выполняет функцию изолятора и сделана из резины. Амортизатор, установленный на задней подвеске, двустороннего действия. Он прикрепляется короткими болтами напрямую к кронштейну, расположенному на продольном рычаге в области задней подвески. В верхней части крепление производится штоковым методом. Шток закрепляется в верхней опоре прямо на пружине подвески. Амортизатор фиксируется сквозь защитную резиновую подушку и опорную шайбу.

Двухрядный упорный подшипник располагается в середине ступицы. По своей структуре он очень схож с подшипником, находящимся в ступице передних колес, однако по размеру он гораздо меньше.

Демонтаж заднего блока

Замена задней балки выполняется после транспортировки автомобиля на смотровую канаву или подъемник. Для начала снимите тормозные колодки, расположенные в задней части ВАЗ 2110. Отсоедините стальные канаты, которыми стояночный тормоз фиксируется к изнаночной стороне балки, прикрепленной сзади к кронштейну.

Теперь отсоедините тонкие тормозные шланги, ведущие к тормозным цилиндрам, находящимся в задней части машины. Отсоедините тормозные трубки, прикрепленные к балке. Кроме того, понадобится отсоединить от балки упругий рычаг, который находится на приводе, отвечающем за регулировку давления.

Используя ключ размером на 17, открутите 4 крепежных болта, держащие ось ступицы совместно с балкой задней подвески. Саму ось снимите вместе со щитом тормозного механизма и при необходимости разъедините их, отвернув два винта крепления при помощи крестообразной отвертки. Отогните скоб и снимите тормозную трубку.

От балки необходимо отсоединить нижние окончания амортизаторов и гайки, прикрепляющие балки к кронштейнам. После этого из балки нужно вынуть болты и осторожно ее снять. Используя головку 17 размера, открутите 3 гайки, прикрепляющие кронштейн к кузову.

Устройство задней подвески: 1 — резинометаллический шарнир; 2 — кронштейн крепления рычага подвески; 3 — кожух амортизатора; 4 — буфер хода сжатия; 5 — крышка кожуха; 6 — опорная шайба; 7 — подушка амортизатора; 8 — распорная втулка; 9 — амортизатор; 10 — изолирующая прокладка; 11 — пружина задней подвески; 12 — соединитель рычагов; 13 — рычаг балки задней подвески; 14 — кронштейн крепления амортизатора; 15 — фланец; 16 — втулка рычага

Замена сайлентблоков

При возникновении скрипов и посторонних шумов в автомобиле необходимо произвести замену изношенных деталей. Это поможет избежать более существенных поломок, которые приведут к сложному и дорогостоящему ремонту. Первое, на что необходимо обратить внимание при проверке работоспособности балок — это сайлентблоки. Их замена производится при помощи специального съемника, изготовленного с использованием нескольких отрезков труб, к которым приваривают шайбы.

Если вы не хотите тратить лишнее время на изготовление, приобретите устройство в любом специализированном магазине. Задние колеса необходимо обязательно зафиксировать, используя специально приспособленные для этой процедуры башмаки или обычные кирпичи. Это необходимо сделать по той причине, что машина, приподнятая домкратом, может соскочить с него и придавить вас.

Выполните снятие приподнятого колеса и проверьте, насколько расшатаны сайлентблоки в рычаге балки. Если они болтаются, необходимо произвести ремонт. Открутите гайку верхней опоры и, нанося короткие удары по сошке, выворачивайте колесо. Удары необходимо наносить до тех пор, пока опора не выскочит. Затем открутите длинный болт, который расположен в верхней части рычага, и приступайте к непосредственному осмотру сайлентблоков передней балки.

Их необходимо выбить сильными ударами молотка по зубилу. Они выскакивают из пазов с легкостью после первого же удачного попадания. Для того чтобы получить большую скользящую способность, предварительно сделайте зачистку старого гнезда. После этого все детали смачиваются мыльным раствором, и методом запрессовки производится вдавливание нового сайлентблока на место старого. Учтите: после того как вы произведете запрессовку, люфты должны полностью отсутствовать, иначе ремонт передней балки пройдет впустую.

Для замены сайлентблоков на нижней балке потребуется приложить гораздо больше усилий. В первую очередь отключите стабилизатор, для того чтобы рычаг получил возможность свободного передвижения. Открутите все гайки, которые держат его в неподвижном состоянии, и выбейте их таким же способом, как и при замене в передней балке. После того как вы запрессуете новый сайлентблок, замену можно считать завершенной.

Обратите внимание на то, что снятие задней балки ВАЗ 2110 производится не в одиночку. Вам потребуется помощь нескольких человек. Они необходимы для поддержки и своевременного опускания задней подвески. Кроме того, выполнять работу по затяжке или ослаблению болтов на колесах автомобиля необходимо только в том случае, когда он стоит на земле.

Выпуск автомобилей десятого семейства давно прекращен, на замену пришла Лада Приора. Наверное, именно поэтому многие детали от Приоры устанавливают на десятку. В этом фотоотчете рассмотрим, как заменить заднюю балку ВАЗ 2110 на Приоровскую .

Чем отличается задняя балка Приоры от балки ВАЗ 2110 ?
В балке от Приоры вварен торсион для усиления. Установка торсиона .

Чтобы выполнить замену балки своими руками Вам потребуется:

  1. Набор ключей со всеми головками и накидными
  2. Специальный ключ для откручивания тормозных трубок
  3. ВД-40
  4. Кусок трубы под ключи

Чтобы удобно открутить гайки крепления балки к кузову нужно обрезать накидной ключ на «19». Перед началом работ предварительно на яме стронуть все гайки и тормозные трубки. Также желательно снять тягу «Колдуна», она одета на шток, на конце зажим в виде обрезанной шайбы.

Теперь поднимаем автомобиль на домкрат, снимаем колеса, барабаны. тормоза, чтобы в результате осталась одна ступица.

Откручиваем 4 ступечных болта рожковым ключом на «17».

Откручиваем в любом соединении тормозные трубки от шлангов. Сделать это нужно где легче, т.к. на снятой балке оставшиеся трубки открутить легче, ну или вообще возможно заменить эти короткие концы. В противном случае можно поменять весь контур.

Откручиваем балку от стоек и от кузова.

Сбиваем ступицы и откручиваем шланги, трубки, скобы крепления ручника.

Если купили балку Приоры без сайлент блоков, тогда впрессовываем полиуретан с помощью съемника для впрессовки (длинный болт, упоры, ВД-40).

Не забываем протянуть ступицы.

Собираем все в обратном порядке. Проверяем соединения трубок и шлангов, затягиваем гайки, прокачиваем тормоза и радуемся.

Заключение

Установка балки от Приоры на ВАЗ 2110 позволила улучшить управляемость автомобиля, пропали уводы и лишние скрипы. Теперь стал проходить повороты более уверенно.

Подушки двигателя. Гидроопора двигателя Как проверить переднюю подушку двигателя

Чтобы машина могла двигаться, ей нужен двигатель. Этот блок устанавливается в передней части корпуса (в большинстве случаев). Устанавливается на подрамнике или на лонжеронах. Однако вибрации, которые издает двигатель при работе, сильно отражаются на кузове. Чтобы их сгладить, его устанавливают с помощью резиновых подушек. Они своего рода буферы. Со временем все резиновые изделия приходят в негодность.Опоры двигателя внутреннего сгорания не исключение. Что такое и методы устранения - далее в нашей статье.

Характеристика

Что это за деталь? Подушка двигателя - это прокладка между кузовом и трансмиссией. Устанавливается на все автомобили без исключения. На советских «Жигулях» подушка представляла собой цельный кусок резины с застежками с двух сторон. На более современные «девятки» и «восьмерки» (а позже и на все ВАЗы с переднеприводной компоновкой) уже устанавливались полноценные резинометаллические подшипники.

Итак, силовой агрегат установлен на четырех подушках. Два из них находятся на коробке передач, остальные - на двигателе. Во избежание лишних нагрузок ящик с мотором жестко закреплен. Любая несоосность приводит к изменению геометрии первичного вала ... В результате вся вибрация сильно передается на рычаг коробки передач и саму трансмиссию.

Где подушки? На двигателе данный элемент установлен с нескольких сторон:

  • Подушка передняя. Крепится к передней балке силового агрегата.
  • Подушка спинки. Подходит к переднему подрамнику. Расположен в нижней части.
  • Опора правая. Расположен вверху, на переднем лонжероне кузова.

Также обратите внимание, что не все автомобили имеют заднюю опору. Эта функция выполняется сама по себе

В этом случае она плотно прилегает к двигателю. Сами подушки бывают разной формы. Часто это алюминиевые или стальные цилиндры с сайлентблоком внутри. Для крепления к туловищу используется так называемая «лапа».Еще у нее резиновая проставка ... Так устроены современные подушки двигателя. Симптомы, как диагностировать деталь, на что влияет износ - мы рассмотрим в ходе этой статьи.

Почему изнашивается?

Многие автомобилисты задаются этим вопросом. Симптомы неисправности опор двигателя могут быть разными. Это в первую очередь связано с естественным износом, вызванным вибрациями. Ресурс этих элементов составляет около 150 тысяч километров. Чем сильнее вибрация, тем больше нагрузка на опору (особенно если в двигателе не работает один из цилиндров).

Если вы думаете, что ресурс напрямую зависит от пробега, то ошибаетесь. Подушка изнашивается даже тогда, когда машина стоит в гараже. Со временем резина высыхает. Появляются микротрещины. Еще один негативный фактор - нефть. Необходимо вовремя менять сальники, чтобы исключить подтёки.

Масло отрицательно сказывается на сроке службы подушки двигателя. Признаки неисправности ВАЗ 2110 тоже могут быть в стиле вождения. Итак, при резком старте со скольжением на опору накладывается колоссальная нагрузка.

Как быстро определить неисправность подушки двигателя?

Можно определить исправность элемента, не открывая капот.

Во время движения вы заметите характерные признаки неисправности подушек двигателя:

  • Имеются характерные стуки и щелчки при трогании с места и торможении автомобиля (спереди).
  • При движении по неровной дороге сильные удары передаются на кузов.
  • На холостом ходу появляется чрезмерная вибрация.
  • При движении возникают удары (особенно при проезде через ямы).
  • Сильная вибрация руля на всех режимах работы двигателя.

Определяем состояние опор визуально

Не всегда вышеперечисленные симптомы укажут именно на неисправность опор двигателя. Итак, если в передней части тела наблюдаются неровности, нужно визуально осмотреть элемент. Мы уже знаем, где он. Итак, открываем капот и смотрим состояние резинового амортизатора.

На нем не должно быть разрывов и трещин. Для большего удобства рекомендуется использовать смотровую яму (особенно если это передняя и задняя опоры). Перемещайте его из стороны в сторону. Между цилиндром и сайлентблоком не должно быть люфта. Если да, то признаки неисправности подушек двигателя подтверждены. Деталь подлежит замене.

Как поменять своими руками?

Для этого вам понадобится набор инструментов (головки и рожковые ключи), домкрат и ремонтные стойки (так как двигатель будет «подвешенным»).Итак, домкратом машину правым боком ... Вешаем мотор на цепь. Откручиваем болты (их всего 3), которые крепят опору к двигателю и кузову. Далее снимаем скобки и вынимаем элемент. Установите новую деталь на место.

Для замены задней опоры домкратом кузов с левой стороны. Однако, в отличие от предыдущего случая, придется повесить и коробку передач. Используем деревянную основу, чтобы не повредить поддон. Откручиваем болты крепления подушки и вытаскиваем.На место старого устанавливаем новый и собираем в обратной последовательности.

Автомобилисты рекомендуют заменять опору в теплую погоду ... Зимой подушка сильно «дубится», и снимать ее можно только после предварительного прогрева (это фен или паяльная лампа). Если опора не выходит, рекомендуется использовать смазку VD-40 или ее аналог от производителя Mannol. Обычная смазка для этого не подойдет.

Часто пыль и влага попадают в полость старой подушки, в результате чего на цилиндре происходят процессы коррозии.Подушка не снимается. Если вы меняете заднюю опору, соблюдайте направление, указанное стрелкой на детали. Его следует устанавливать по направлению к автомобилю. В противном случае есть риск, что элемент не выдержит нагрузок и отломится.

Заключение

Итак, мы выяснили основные симптомы неисправности подушек двигателя. Опора двигателя внутреннего сгорания - очень важная деталь в автомобиле. Поэтому нужно знать, как определить его неисправность и как заменить деталь на новую.Надеемся, эта статья помогла вам решить эту проблему.

Двигатель автомобиля достаточно тяжелый и подвержен вибрации, поэтому его необходимо предохранять от смещения во время работы. Если точки крепления жестко соединить с элементами кузова, то они очень быстро выйдут из строя, так как при движении по неровному дорожному покрытию точки крепления будут воспринимать значительные знакопеременные нагрузки.

Plus, весь кузов будет постоянно вибрировать, что, помимо дискомфорта для находящихся внутри автомобиля, также отрицательно скажется на долговечности всех элементов автомобиля.

Подушка (опора) двигателя ВАЗ

Запись

Специальные опоры, или как их еще называют, подушки служат для гашения колебаний при работе двигателя и надежной его фиксации.

Название подставки не случайно, так как полностью соответствует своему назначению. Так в толковом словаре Ожегова одно из значений слова «подушка» - это то, что является опорой чего-либо, принимает на себя давление механизма.

Основная задача установки опор - обеспечить надежное крепление и минимизировать боковое смещение при эксплуатации.

Кроме того, благодаря подушкам силовой агрегат изолирован от всех частей кузова, что делает управление автомобилем комфортным.

В зависимости от модели автомобиля двигатель может иметь от 3 до 5 подушек.

Таким образом передние и задние подушки безопасности отслеживают вибрацию на холостом ходу и при максимальной нагрузке двигателя.

Дизайн

Самая простая опора - это резинометаллический элемент, в котором между двумя стальными пластинами помещен слой резины.Пластины имеют на концах резьбовую часть в виде шпильки для соединения с корпусными частями. Такие изделия могут быть как цельными, так и разборными.

Некоторые опоры, например классические модели ВАЗ 2101-07, внутри подушки также имели пружину и резиновый отбойник, что увеличивало жесткость и смягчало сильные удары.

В последнее время все чаще вместо резины производители стали использовать полиуретан, как наиболее износостойкий, а металл в большинстве случаев уступал место алюминию.

Для более дорогих моделей автомобилей для большего комфорта при движении используются более современные конструкции, например, гидравлические опоры. Они состоят из двух камер и перегородки между ними, камеры заполнены жидкостью, которая под нагрузкой может переходить из одной емкости в другую.

Такие опоры могут адаптироваться к работе силового агрегата в любых режимах его работы и способны максимально гасить любые возникающие колебания, существенно повышая степень комфорта при управлении автомобилем.

Наибольшие нагрузки на подушки двигателя возникают при запуске, запуске и остановке. транспортное средство. Неисправная опора увеличивает нагрузку на двигатель и трансмиссию, увеличивая вероятность их поломки.

Неисправности:

Трещины, разрывы на корпусе наполнителя или стальных пластинах;

Деформация подушки;

Отделение резины от металла;

Признаки неисправности:

Мотор "подпрыгивает" при трогании с места и торможении автомобиля;

Удар при строгании на заднем ходу;

При движении по неровной дороге слышны стуки, похожие на неисправность ходовой части.

Причины неисправности

Причин преждевременного выхода из строя подушки может быть несколько. Так, например, при тюнинге автомобиля устанавливаются амортизаторы с более жесткой характеристикой, низкопрофильные шины для улучшения управляемости и изменения внешнего вида авто. Однако в этой ситуации амортизаторы на ямах не полностью гасят колебания кузова, что отрицательно сказывается на всех элементах, в том числе на опорах двигателя.

Манера вождения. Это резкие запуски и торможение, вызывающие огромные нагрузки на опоры двигателя из-за быстрого смещения центра тяжести.Сюда же следует отнести прохождение неровностей дороги без снижения скорости.

Естественный износ. Это механические нагрузки, перепады температур, старение резинового наполнителя, теряющего эластичность.

Условия замены

Средний поддерживает силовые установки, способные проехать около 100 тысяч километров и более (до 200 тысяч) при умеренной езде и правильном контроле за своим состоянием.

При обнаружении признаков неисправности двигателя и опор коробки передач рекомендуется незамедлительно их заменить.При этом не стоит приобретать продукцию неизвестного производителя, отдавая предпочтение оригиналу.

Наконец. Удобные в обслуживании опоры означают комфорт и безопасность вождения, а также продлевают срок службы вашего силового агрегата.

Своевременная профилактика - залог долгой эксплуатации автомобиля и безопасности при его эксплуатации. По этой причине желательно, чтобы каждый водитель самостоятельно следил за своим автомобилем. Для комплексного выполнения плановых операций не будет лишним умение проверить исправность подушек двигателя.

Читайте в этой статье

Типы и типы подушек двигателя

Перед тем, как что-либо проверять, также необходимо понять назначение детали, какие неисправности элемента могут возникнуть, а также какие симптомы имеет поломка. Как известно, двигатель много весит и при работе вибрирует. Это значит, что если он будет жестко прикреплен к кузову автомобиля, то все колебания будут передаваться на последний.

При движении по неровностям места крепления силового агрегата испытывают значительные нагрузки.Жесткое крепление к корпусу будет означать, что крепеж и место их установки начнут быстро ломаться. Чтобы общая конструкция была надежной и поддерживалась комфортность; Для крепления ДВС используются специальные опоры.

Подушка (опора двигателя) - деталь, которая служит для фиксации силового агрегата, препятствует его смещению и гасит вибрации при работе. По своей сути это настоящая прокладка, просто довольно больших размеров ... Ставится между двигателем и кузовом автомобиля, то есть крепится как к силовому агрегату, так и к самому кузову.Количество подушек зависит от марки и модели автомобиля, их от трех до пяти.

Если открыть капот, сразу видно верх (правая опора). Остальные находятся на нижней стороне мотора. Опять же, точки размещения различаются в зависимости от модели автомобиля, типа двигателя и типа коробки передач. В большинстве случаев подушки двигателя состоят из резинового кожуха и металлических креплений.

Иногда вместо резины используют полиуретан, более износостойкий. В дорогих авто более сложные и современные варианты - гидравлические.Эффективность гашения вибрации, естественно, намного выше.

Такие подставки состоят из двух камер, между которыми расположена мембрана. Камеры заполнены пропиленгликолем или специальной жидкостью (гелем). Во время работы в зависимости от дорожных условий (например, от неровностей) она переливается из одной камеры в другую по специальным каналам, а общая жесткость подушки динамично меняется за счет такой конструкции.

Гидроопоры разные:

  • С электронным управлением... Компьютер изменяет жесткость опоры, принимая и обрабатывая сигналы - вибрации, сила которых меняется в зависимости от ситуации. Жидкость внутри такой подушки часто содержит частицы металла, и ее плотность изменяется под действием магнитного поля. Благодаря таким технологиям можно добиться максимального комфорта в салоне автомобиля вне зависимости от режима работы двигателя и дорожных условий;
  • С механическим управлением ... Вариант попроще. Технические характеристики задаются на этапе сборки.От них зависит, в каком режиме будет максимальная выгода: на холостом ходу или в разных режимах работы двигателя.

Конечно, высокотехнологичные устройства устанавливаются на очень дорогие автомобили ... На бюджетных вариантах, а тем более на старых советских моделях устанавливаются простые резинометаллические опоры. В случае поломки или износа (обычно выдерживают около 100000 км) их просто меняют. И гидравлику можно отремонтировать. И даже самостоятельно. Однако перед тем, как снимать крепления, нужно знать, как проверить гелевую подушку двигателя, резиновую подушку и т. Д.

Признаки и причины проблем с подвеской двигателя

Основными признаками неисправности подушек (подушек) двигателя являются:

  • сильная вибрация руля при работающем двигателе;
  • стук в районе установки КПП при движении по неровностям;
  • при движении и переключении передач на большой скорости;
  • стук под капотом при преодолении неровностей дороги, а также на холостом ходу и при изменении нагрузки при работающем двигателе;

При появлении этих признаков стоит провести диагностику подушек.Вы можете сделать это сами.

Проверка подушек двигателя своими руками

Поставить такой диагноз совсем не сложно. Даже если в машине есть гидравлические подушки. Главное знать, как правильно проверить правильную подушку двигателя, а также провести диагностику остального. Это можно сделать несколькими способами, которые лучше всего использовать в сочетании друг с другом для более точной диагностики.

  • Первый способ подходит для гидравлических опор.Поставьте автомобиль на ровную поверхность, откройте капот и запустите двигатель. Затем попробуйте немного пошевелиться.

Если подушки безопасности неисправны, двигатель сдвинется с места. При этом будут отчетливо слышны характерные звуки ... Аналогичную проверку можно провести на неработающем моторе, если вставить монтировку или палку между мотором и кузовом автомобиля и попытаться раскачать силовой агрегат от бок о бок.

  • Второй способ проверки следующий. При работающем двигателе нужно включить передачу и трогаться на несколько сантиметров.На разных типах При неисправности подушки безопасности можно почувствовать характерные рывки.
  • Для проверки нижних опор понадобится смотровая яма, домкрат и деревянный настил высотой около полуметра. Подняв одно колесо и заменив домкрат на деку, нужно осмотреть низ подушки на предмет трещин, надрывов, подтеков гидравлической жидкости ... Конечно, перед этим необходимо принять меры безопасности, исключающие движение автомобиля. с места (блокировка отката под задним колесом и т. д.).

Чтобы опоры прослужили как можно дольше, нужно следить за своим стилем вождения. Принцип «выше скорость - меньше дырок» должен навсегда выкинуть из головы. Кроме того, опоры двигателя с большей вероятностью выйдут из строя, если вы будете часто и резко трогаться с места. Одним словом, чем меньше резких колебаний ДВС, тем реже потребуется проверять исправность подушек двигателя.

Читайте также

Почему двигатель может вибрировать на холостом ходу.Причины поломки, диагностика. Советы и рекомендации по снижению вибрации двигателя.

  • Замена подушек двигателя: по каким признакам можно понять, что нужно менять подушки. Виды опорных подушек, как поменять подушки двигателя своими руками.
  • Опора двигателя - крепежное приспособление, с помощью которого силовой агрегат устанавливается на транспортном средстве. Помимо функции застежки, он выполняет роль подушки. Для этого опору также часто называют опорой двигателя , но по-английски это звучит как опора двигателя.Также в зависимости от конструкции подставку можно назвать «гитарой», так как по форме напоминает этот музыкальный инструмент.

    Как правило, используется не одна, а несколько (чаще всего три) опоры. Их задача - поглощать вибрации работающего двигателя и сохранять его максимально статичным. Поскольку он обязательно будет вибрировать в работе, и это не зависит от степени его мощности и совершенства. Установка двигателя на подушку-опору позволяет не только повысить комфорт езды, но и защитить силовой агрегат от ударов и толчков при движении по неровностям.

    Опоры изначально были простыми металлическими креплениями, жестко притягивающими двигатель к опорной конструкции. Фактически использовалась только опора двигателя в современном понимании. Затем в механизм были добавлены резиновые подушки, которые повысили эластичность крепления, за счет чего удалось обеспечить более упругую подвеску мотора. Эта металлическая резиновая опора двигателя широко используется и сегодня.

    Где находится опора двигателя

    Многие автовладельцы даже не знают, как выглядят опоры, не говоря уже о том, где они находятся.Так как если не залезть под машину, то опорные подушки скрыты из виду, из подкапотного пространства хорошо видна только верхняя. Места установки и количество точек опоры двигателя на кузове автомобиля зависят от типа и расположения под капотом двигателя и коробки передач, а также от самой марки автомобиля. Основная задача установки крепления - надежность и минимальное смещение по бокам при эксплуатации. Классическая схема установки двигателя на опоры на 3 точки снизу и на 2 точки вверху.Кстати, на такую ​​подушку устанавливают не только машины ДВС, но и редуктор на резинометаллических подшипниках. Поэтому необходимо четко разделить, где двигатель, а где коробка.

    Типы опор

    Современная опора подвески двигателя может быть резинометаллической или гидравлической .

    Конструкция резинометаллических опор предельно проста: пара пластин из стали или другого металла с не слишком толстой прокладкой между ними из хорошей износостойкой резины.Это самая дешевая и популярная сейчас опора двигателя. В некоторых моделях в подушки дополнительно устанавливаются пружины, увеличивающие жесткость, и буферы, несколько смягчающие сильнейшие удары. Все чаще новые автомобили производятся с подушками из полиуретана, что связано с его большей износостойкостью. Это полиуретановая подушка опоры двигателя, которая используется в спортивных автомобилях, поскольку она увеличивается для оптимизации жесткости. Резино-металлическая опора двигателя может быть разборной или неразборной.

    Устройство гидравлической подушки двигателя.

    Гидравлическая опора двигателя считается гораздо более современной конструкцией. Такие системы способны адаптироваться к работе двигателя в различных условиях и максимально эффективно гасить любые вибрации. Подушка опоры двигателя также состоит из трех основных элементов, но здесь это пара камер, между которыми расположена мембрана. Каждая из камер заполнена антифризом или гидравлической жидкостью. Подвижная мембрана предназначена для устранения незначительной вибрации, возникающей на холостом ходу и низкой скорости на ровной дороге.Высокоскоростные вибрации устраняются гидравлической жидкостью. Под действием изменяющегося давления он перемещается между камерами, увеличивая жесткость опоры, что позволяет гасить даже самые сильные колебания.

    Гидравлическая опора двигателя в отличие от резинометаллической опоры может иметь различную конструкцию. На данный момент распространены следующие типы опор двигателя:

    • механически управляемые опоры, способные очень эффективно гасить один из видов вибраций (холостой ход, скоростные, сильные удары), поэтому конфигурируются по-разному для каждой модели автомобиля;
    • опоры с электронным управлением, которые в основном устанавливаются на дорогие автомобили, но способны автоматически изменять характеристики жесткости для эффективного противодействия всем видам рабочих вибраций;
    • динамические опоры, основанные на использовании магнитной металлизированной жидкости, изменяющей вязкость под действием магнитного поля, которое, в свою очередь, управляется автомобильной электроникой, за счет чего достигается адаптивность настроек опор.

    Однако распространенной можно считать только опору двигателя первого типа, так как остальные слишком сложны и дороги для использования на действительно массовых автомобилях.

    Особенности эксплуатации

    При возникновении чрезмерной вибрации двигателя проверьте целостность подушки двигателя.

    Подушка двигателя является изнашиваемой деталью, так как она работает при работающем двигателе. Самым большим испытанием для опор является запуск двигателя, трогание с места и остановка автомобиля. В такие моменты нагрузка на опоры наибольшая.Износ или поломка этой детали увеличит нагрузку на двигатель и увеличит вероятность выхода двигателя из строя.

    Трещины и разрывы на опорной подушке видны, если для этого проводится профилактический осмотр, но такие симптомы, как повышенная вибрация с отдачей на рулевое колесо при работающем двигателе или переключение передач с толчками, а также если подушка возле КПП изношен, может выбить скорость. Тогда очевидные факты на первый взгляд, нужно купить набор новых опор в линейке и начать замену.

    Появление трещин или отслоение резиновой части опоры от металла - весомый аргумент для замены.

    Имея под рукой комплект ключей, домкрат и смотровую яму, в принципе, можно поменять самостоятельно без особых навыков, хотя бывают случаи, когда процедура замены опор двигателя - занятие весьма забавное.

    Следить за состоянием резинометаллических подшипников несложно: нужно просто проверить целостность резиновой прокладки и регулярно удалять с нее грязь и масло, подтягивать болты крепления.

    В среднем опора двигателя обслуживает около 100 тысяч километров. Но правильный уход позволяет избавиться от линий эксплуатации, причем не только самих опор двигателя внутреннего сгорания, но и состояния двигателя в целом.

    Если автомобиль оборудован гидравлическими опорами, откройте капот и запустите двигатель, чтобы проверить их. Далее нужно пару сантиметров погонять вперед-назад. Если с опорами что-то не так, двигатель сдвинется с места при запуске и вернется на место при остановке, что будет сопровождаться хорошо слышными звуками.

    Независимо от того, какие опорные подушки удерживают двигатель на вашем автомобиле, совет является общим для всех. Не допускать резких поломок, тем самым давая максимальную нагрузку на опоры, поперечные выбоины и неровности на высоких скоростях, чтобы вибрации мотора были минимальными, и поэтому вибрации, которые необходимо поглощать опорами двигателя, не будут существенный.

    Комфортность езды во многом зависит не только от качества подвески, но и от хорошей звукоизоляции.Но со временем они могут проникнуть в салон посторонних ударов и вибрации. Обычно это связано с сайлентблоками рычагов подвески. Но сегодня мы поговорим еще об одном резинометаллическом элементе. Это называется подушкой. Что такое подвеска двигателя и каковы ее симптомы? Об этом мы поговорим в нашей сегодняшней статье.

    Характеристика

    Что это за элемент? Задняя и передняя подушки двигателя представляют собой резино-металлическое изделие - сайлентблок с элементами крепления.Ее еще называют опорой двигателя внутреннего сгорания. Как передние, так и задние подушки двигателя выполняют единственную функцию - гашение вибраций, создаваемых двигателем.

    Двигатель постоянно работает под нагрузкой. И даже на холостом ходу неизбежны вибрации. Для их выравнивания предусмотрены сайлентблоки. Через них мотор соединяется с кузовом. Передние и задние опоры снижают вибрацию двигателя на холостом ходу и при высоких нагрузках.

    Типы, расположение

    Деталь крепится в нескольких местах.На двигателе работают две опоры - правая и передняя. Также на КПП можно разместить одну подушку. Но возможна и другая схема:

    • Правая подушка безопасности находится на лонжероне кузова автомобиля и крепится сверху.
    • Передняя опора закреплена на балке ДВС. Расположен внизу.
    • Задняя подушка безопасности находится на полу или прикреплена к переднему подрамнику (если он есть). Также находится внизу.

    Сама опора может быть алюминиевой или стальной. Последний вариант часто используют на недорогих автомобилях ... Но какого бы типа и количества они ни были, выход из строя хотя бы одной из опор влечет за собой необратимые последствия. Далее мы рассмотрим основные симптомы неисправности опоры двигателя.

    Как определить поломку?

    Это достаточно легко вычислить. Поскольку основное назначение опоры - гашение колебаний, такая машина сразу же начнет издавать повышенные колебания.Они будут передаваться не только на руль, но и разноситься по всему телу. Причем не только на холостом ходу, но и на высоких оборотах (правда, характер колебаний изменится). Также будут ощущаться удары по крыльям. При трогании с места и резком торможении вы услышите характерные щелчки или стуки в передней части автомобиля. При движении по неровной дороге будут возникать толчки, похожие на неисправности подвески.

    Таким образом, основным признаком неисправности опоры двигателя является вибрация, которая делает управление автомобилем некомфортным.

    Причины

    Почему это происходит? Есть несколько причин, по которым выходят из строя передние и задние подушки двигателя:


    Посторонние жидкости

    Это еще один фактор, влияющий на срок службы подшипников. Но мало кто о нем упоминает. Ранее мы говорили о таком понятии, как «мойка двигателя». Значит, именно эта операция может существенно продлить срок службы опоры.

    Дело в том, что при длительной эксплуатации мотор начинает покрываться потеками масла.Они оседают везде - на элементах зажигания, блоке цилиндров, коробке передач и, конечно же, на подушках. Как известно, масло и резина - понятия несовместимые. При попадании смазки на опорную поверхность последняя начинает терять эластичность. В результате ресурс сайлентблока значительно снижается. То же касается и других жидкостей - антифриза, «тормоза», бензина. Удар их о поверхность опоры крайне нежелателен. Регулярно промывая двигатель, можно не только продлить срок службы опоры, но и вовремя диагностировать ее неисправность, а также другие элементы и навесное оборудование.

    Как заменить? Инструменты для готовки

    Единственный выход из ситуации повышенной вибрации - установка новой опоры. Он не ремонтируется и полностью заменяется. Для этого вам понадобится такой набор инструментов:

    • Набор головок и гаечных ключей.
    • Новые подушки.
    • Жидкая смазка ключа.

    Работы лучше проводить на яме или подъемнике. Если таковых нет, используем домкрат и останавливаемся.

    Приступая к работе

    Итак, вывешиваем переднюю часть корпуса и подкладываем под мотор предохранительную планку (так как агрегат будет практически висеть в воздухе).Слегка опустите кузов, чтобы двигатель упирался в блок. Откручиваем крепления, которые идут к лонжерону.

    Затем снимите болты, которыми опора крепится к раме. Лучше подписать их, чтобы не возникало проблем с установкой. Далее снимаем старые подушки и таким же образом устанавливаем новые. Никаких съемников или специальных инструментов не требуется. Однако диаметр болтовых соединений может отличаться в зависимости от типа и марки автомобиля.

    При установке новых опор нанесите на резьбу небольшой слой резьбового герметика.Это предотвратит несанкционированное ослабление болтов во время работы и защитит резьбу от грязи и коррозии. Опоры рекомендуется менять комплектом, чтобы в ближайшее время не делать повторный ремонт. Обратите внимание также на момент затяжки. На автомобилях ВАЗ «десятого» семейства передняя и правая опоры затягиваются с усилием 54-70 Нм. Дополнительная задняя - 90-120 Нм. На этом процедуру замены подушки можно считать завершенной и приступить к ежедневному использованию.

    Узнал, что пора менять сайлентблоки. Сайлентблоки

    Придя на диагностику в автосервис, можно услышать, что в автомобиле были изношены сайлентблоки. Для новичков, которые только начинают учиться обслуживать свой автомобиль самостоятельно, это слово будет непонятным. Изучив этот материал, начинающие автолюбители узнают, что это петли, где они расположены, как определить неисправность в этом узле и главное, как заменить сайлентблоки рычагов ВАЗ 2110

    Назначение и расположение сайлентблоков

    Само слово «сайлентблоки» произошло от иномарок, раньше эти элементы назывались резинометаллическими шарнирами.Деталь представляет собой соединение двух металлических трубок, между которыми находится вставка из резины. В задней и передней подвеске установлены сайлентблоки. Задача этих элементов - изменять углы расположения колес ВАЗ 2110. Также они объединяют части подвески и гасят колебания, возникающие во время езды.

    Важно! Примерный ресурс сайлентблоков - 100 тысяч километров, но иногда эти детали изнашиваются раньше срока.Срок службы зависит от многих факторов: стиля вождения, гаража, регулярности Диагностика ВАЗ 2110.

    В этом материале будет разбираться замена сайлентблоков в передней подвеске, так как здесь на них большие нагрузки, как следствие изнашиваются резиновые лапы, трубки. Эти детали ВАЗ 2110 устанавливаются на задние и передние рычаги. Петли также используются в качестве опор двигателя, коробки передач и амортизаторов. Замена может производиться самостоятельно при наличии смотровой ямы и домкрата.

    Признаки неисправностей

    Определить, что причина неисправной работы передней подвески в сайлентблоках довольно проста, довольно просто. Признаки неисправности этих деталей следующие:

    • Из-под передних колес ВАЗ 2110 из-за шума, издаваемого колесами, идет неестественное скручивание резины.
    • Внешний вид стука в передней части автомобиля. Это связано с износом резинометаллических шарниров, которые перестают скользить, в результате появляется шум.
    • Также неисправность можно определить при визуальном осмотре - на резине появляются трещины, изломы и другие дефекты.
    • При появлении этих знаков нужно достать петли с заднего и переднего рычагов и осмотреть их на предмет повреждений. Ремонт металлических резинометаллических петель не поддается, поэтому требуется замена деталей на новые.

    Замена сайлентблоков ВАЗ 2110: Необходимые инструменты

    Для работы потребуются следующие инструменты и оборудование:

    • Съемник.
    • Набор ключей.
    • Набор отверток.
    • Молоток.
    • Тиски.
    • Долото.
    • WD-40.
    • Ищем яму и домкрат.

    Съемник - важнейший инструмент, так как демонтаж сайлентблоков и замену без съемника выполнить невозможно. Устройство можно купить или сделать самому. Съемник состоит из широкой и толстой шайбы, высокой гайки, болта М12 и втулки, длина которой составляет 60 мм, а внутренний диаметр - 38 мм.

    Инструкция по замене сайлентблоков нижних и поворотных рычагов

    Идет замена сайлентблоков передних рычагов следующим образом:

    1. Машину нужно поставить на яму. Если на ВАЗ 2110 присутствует защита моторного отсека, то ее необходимо демонтировать. Далее следует открутить гайки с болтов, удерживающих передние рычаги. После этого можно открутить гайки болтов, соединяющих рычаг и стабилизатор. После снятия колесных болтов машину нужно поднять домкратом и демонтировать колесо;
    2. Вооружившись ключом «24», необходимо открутить гайки растяжек.Если насадки не поддаются лечению, их нужно обработать WD-40. После снятия гайки поворотный кулак и шаровую опору можно разделить. Теперь передний рычаг можно полностью снять;
    3. Готово, теперь можно добраться до неисправных сайлентблоков. Далее следует взять новые детали и с помощью тисков вдавить их в рычаг. Для начала нужно поставить солент-блоки растяжки. Редко бывает, что блок полностью сел в рычаг, его можно зафиксировать несколькими ударами молотка;
    4. Следующим этапом займемся сайлентблоками рычагов.Если изделие полностью изношено, оно выпадет после удара молотка. Новую деталь перед установкой в ​​рычаг необходимо смазать. Как показывает опыт владельцев ВАЗ 2110, смазывать лучше всего мыльной водой или жидким мылом. Готово, замена завершена, сборка производится в обратной последовательности.

    Совет! Растянутые гайки очень сложно открутить, поэтому лучше не тратить 10 минут на каждый виток резьбы, а демонтировать рычаг с натяжкой.

    Чек Сайлентблок

    Иногда невозможно сразу определить деталь ВАЗ 2110 или нет. Проверить сайлентблоки можно без разборки. Для этого нужно пройти на смотровую яму и осмотреть петлю - она ​​должна быть чистой, иначе повреждений не заметить. Резиновая часть петли не должна иметь разрывов и трещин. Еще один признак поврежденной детали - неправильное разрушение / схождение. При порвании петель нижний и поворотный рычаги теряют устойчивость и искривляются.

    Также необходимо проверить люфт, если он слишком большой, необходимо будет заменить. Откладывать ремонт не рекомендуется, так как неисправные резинометаллические петли негативно сказываются на управляемости ВАЗ 2110: машина берет и выкидывает.

    Сайлентблок задней балки - резинометаллический шарнир. Деталь служит эластичной вставкой между транспортными средствами автомобиля. Он представляет собой два рукава, между которыми находится резиновый уплотнитель или другой эластичный материал. Недавно в раздачу получил полиуретан.Прокладка из эластичного материала позволяет гасить колебания между узлами и не передавать колебания на кузов автомобиля.

    Сайлентблок задней балки служит не только для соединения узлов подвески. Элемент также прикреплен к стабилизатору поперечной устойчивости, в местах коробки передач и двигателя двигателя. Но в подвеске самые тяжелые условия эксплуатации из-за пыли, грязи, влаги и активного движения деталей, поэтому замена производится регулярно.

    Резиновые втулки - это не те элементы, которые служат вечно. Обычно хватает на 100 тысяч км пробега, но из-за тяжелых условий эксплуатации срок замены может наступить раньше. По истечении половины этого срока необходимо проверить подвеску. Только так можно понять степень износа узла и определить, нужно ли его менять.

    Порядок проведения визуального осмотра:

    • загнать машину в яму или поднять домкрат;
    • очистить от грязи узлы крепления подвески;
    • осмотреть.

    Резиновая вставка не должна иметь трещин и разрывов. Приметы такого рода говорят о том, что пора заменить сайлентблоки задней балки. Изношенный предмет впоследствии повлияет на управляемость, а это, в свою очередь, скажется на безопасности владельца автомобиля и окружающих.

    Иногда деталь изнашивается раньше, особенно при движении по бездорожью. Степень износа можно оценить по поведению автомобиля.

    Признаки износа сайлентблоков:

    • при движении по прямой или при торможении автомобиль тянет в сторону;
    • повышенный износ резины по бокам;
    • повышенная вибрация при движении;
    • скрип или стук в области подвески;
    • подвеска начала усиленно работать.

    Наличие одного или нескольких знаков означает, что отстранение пора отбывать. Удаление может быть дорогостоящим. Несвоевременная замена приведет к потере управления в критической ситуации, а также к ускоренному износу шин. Пострадают и места посадки петель и тогда придется менять рычаг - это увеличит стоимость ремонта.

    Металлические части деталей ломаются крайне редко. В тренде обычно резиновая прокладка.

    Причины преждевременной замены:

    1. Длительная эксплуатация, приводящая к высыханию резинового уплотнения и потере свойств.
    2. Взаимодействие с химическими веществами. Нефть и бензин разрушают резину.
    3. Неправильная установка.

    Преждевременный износ говорит о том, что необходимо найти причину и устранить ее. В этом случае в ближайшее время процедуру замены придется повторить. Нагрев масла будет хорошо виден, а установку следует проводить строго по инструкции и проверять соединения.

    Правильный выбор

    Выбор делается после диагностики неисправности или при плановой замене.Необходимо понимать, какую роль элемент выполняет в подвеске. Ее задача - гасить колебания, неизбежно возникающие из-за неровностей дороги.

    Колебания при движении передаются на подвесные рессоры, где амортизаторы частично гасятся. Далее вибрация распространяется на раму через узлы привязки. Частично гасится сайлентблоками за счет наличия мягкой основы между рукавами. Поэтому качество основания должно быть высоким.Заводская версия подвески оснащена сайлентблоками на резиновой основе. Это проверенный материал, но есть и лучше - например, полиуретан.

    Преимущества полиуретана:

    1. Срок службы увеличен в 5 раз. Это позволяет произвести замену и агрессивно нагружать подвеску через большие зазоры.
    2. Повышенная термическая стабильность. Полиуретан хорошо переносит температурные перепады. На морозе материал работает так же хорошо, как и при высоких температурах.
    3. За счет плотной структуры материала повышается управляемость автомобиля.

    Резина и полиуретан пользуются одинаковой популярностью. Сами водители выбирают, на что делать упор. Резиновые прокладки могут повысить комфорт при вождении, а также можно улучшить управляемость с помощью полиуретана. Но в последнем случае комфортность снижается, особенно ощущаются пассажиры.

    Приобретая товар, лучше проконсультироваться у специалиста в магазине.Дело в том, что виброизоляторы внешне сложно отличить друг от друга - они практически похожи. Но их внешний диаметр иногда несколько отличается, что вызовет затруднения при установке.

    Процесс демонтажа и установки

    Установка начинается после покупки запчастей. Потребуется инструмент - ключи для снятия балок и рычагов подвески, молоток или кувалда.

    Пошаговая инструкция:

    1. Автомобиль напился на яме или подъезде.Поднять колесо на домкрате можно, а вот с подвеской работать неудобно - надо работать. Нахлест домкрата не должен стоять в одной плоскости с кронштейном балки.
    2. Снять балку подвески. Обязательно снимите трос ручного тормоза.
    3. Скобы имеют специальные скобы, в которых тормозные шланги удерживают шланги. Скобы удалены.
    4. Разобрать старый сайлентблок балки. Условия гаража предполагают использование молотка или кувалды. Следует быть очень осторожным, чтобы не повредить сиденье, иначе возникнут проблемы с установкой новой детали.
    5. Место посадки очистить от грязи, нанести туда графитовую смазку.
    6. Установить новый элемент. Замена задней части задней балки производится так, чтобы не было зазоров и дырок. Нажатие делает молоток аккуратными ударами.
    7. Соберите балку в обратном порядке.

    Замена завершена и сразу едем на авто. Во время сборки следует проверять установку каждой детали и только после этого приступать к сборке следующих. По такой же схеме меняют сайлентблок передней балки.

    Демонтаж старой резинки производится за 3 - 4 сильных удара кувалдой. Балка должна находиться строго по центру детали, не отклоняясь в сторону от вертикальной оси. Кромка климата загибается с помощью стамески для облегчения демонтажа.

    Опытные мастера используют отрезок трубы для демонстрации сайлентблока задней балки. Важно, чтобы его диаметр был несколько меньше, чем на том же месте посадки. Трубку прикрепите к деталям и бейте по ней молотком.За несколько выстрелов деталь будет удалена без лишних операций.

    После снятия задней части задней балки проверьте сиденье. На нем не должно быть сколов и трещин. Если есть, элемент следует заменить. Иначе новый сайлентблок не будет стоять как надо.

    Нарисовано своими руками

    Демонтаж и штамповка новой детали - сложные этапы работы, особенно последняя. Поэтому установку сайлентблоков задней балки следует производить с помощью специального приспособления - сиденья.Его можно сделать самостоятельно или попросить у друга. Детально бить молотком не нужно, поэтому повреждение невозможно.

    Сайлентблок - деталь автомобиля, задачей которой является снижение шума подвески. Сайлентблок - это промежуточное звено между элементом подвески (подрамник, пружина, амортизатор, рычаг и т. Д. И жесткой конструкцией кузова). Если вы прикрутите металлическую часть подвески к металлической части кузова, вы отлично услышите каждое колебание подвеска, соединение будет слишком жестким, что снизит уровень комфорта автомобиля.

    Как устроен Сайлентблок

    По сути, сайлентблок, это цилиндр, внутри которого вставлена ​​резина, и чтобы резина не выходила за крепежный болт, меттаричная втулка вставлена ​​в резину. Смотрите картинку, как она выглядит вживую.

    В итоге все удары по подвеске проглатывают резиновую деталь, а по кузову почти ничего не доходит.

    Как понять, что вышел из строя сайлентблок

    Все просто: он перестает выполнять свои функции, и вы начинаете слышать удары при движении по неровностям с большой амплитудой хода колеса (рельсы, глубокие неровности).Если подвеска начинает стучать, осмотрите ее с ямы. С выдающимся сайлентблоком резиновая часть излома, и во время движения рычага видно, что сайлентблок позволяет слишком сильно сдвинуться к вашей внутренней втулке.

    Так как сайлентблок не может больше удерживать подвеску в сборе, четкость подвески нарушается, машина может начать оживать, требуя друга. Конечно, о нормальном развале нельзя будет говорить, но подвеска не сможет настроить подвеску, так как при смещении автомобиля развал будет постоянно меняться.Хороший метод диагностики: пневмошибка, создающая на колесо достаточно большую нагрузку, в результате чего все больные места вылезают наружу.

    Какие бывают сайлентблоки

    Они устроены все одинаково, однако для предотвращения передачи большого количества шума или для увеличения подвижности резиновая деталь часто бывает не цельной, а как часть двух частей, соединенных перегородками. Иногда для снижения износостойкости резиновую деталь заменяют полиуретановым аналогом.Сайлентблоки полектопии несколько жестковаты и шумнее, но в целом их поведение больше.

    Причины выхода из строя и что ломается в сайлентблоке

    Присутствует сломать металлические части сайлентблока довольно сложно. Если говорят, что сайлент блок сломался, значит, металась резиновая составляющая детали или уже сломалась. Причин выхода из строя сайлентблока три:

    • Длительный срок службы, в результате чего брусок высох, потерял эластичность, начал трескаться и ломаться
    • Химическое воздействие на резиновую деталь.Например, на сайлентблоке, по которому он работает, слишком много масла.
    • Неправильная установка. Болты блока Сайлент нужно тянуть только тогда, когда автомобиль стоит на колесах, а не на весу. Но увы, многие автосервисы не соблюдают это правило, в результате затянутый колесом колесо находится в крайней точке, и когда оно стоит на колесах, сайлентблок сильно перекручивается и резина со временем надоест. , без выздоровления и трети срока. Еще один тонкий момент - установка сайлентблока с перегородками.Такие сайлентблоки можно устанавливать в строго определенном положении, и при неправильном расположении сайлентблок очень быстро выйдет из строя.

    Как заменить сайлентблок

    Как правило, сайлентблок сначала прикручивается к одной детали или замыкается в нее, которая совмещает ее с внешней оболочкой, после чего деталь ставится на место и прикручивается болтом, сдвинутым через внутреннюю часть. гильза сайлентблока.

    Зная, как устанавливается сайлентблок, несложно догадаться, какой извлекается либо со стуком, либо путем откручивания.При выбивании или пересчете очень важно не повредить самолет, сопрягая сайлентблок и элемент подвески, так как сайлентблок в этом случае может входить в него незакрепленно или не давить.

    При установке обратите внимание на то, как должен стоять сайлентблок, так как не все сайлентблоки можно поставить произвольно. Если сайлентблок имеет конструкцию с перегородками, он должен иметь строгое рабочее положение. Если проигнорировать позицию строгой установки, нагрузка на перегородку будет слишком велика и сайлентблок выйдет из строя.

    Подвешивание подвески с подключением через сайлентблок выполняется исключительно в «положении машины на земле», так как подвеска перед перетаскиванием должна занять рабочее положение. При игнорировании этого правила сайлентблок закручивается и его ресурс значительно уменьшится.

    Сайлентблоки в автомобиле можно найти практически в любой композитной подвеске или в крепежных элементах двигателя. Рассмотрим назначение сайлентблоков, когда их следует менять и в чем они состоят.

    Чаще об их замене узнают, когда они выходят из строя, при этом спрашивают, для чего они предназначены. Чтобы во всем разобраться, рассмотрим подробнее сайлентблок, его составные части и назначение.

    Почему служит сайлентблок


    Резинометаллический шарнир или более известный элемент как сайлентблок предназначен для уменьшения колебаний в подвеске, но в некоторых автомобилях они устанавливаются на двигатель или другие движущиеся механизмы подвески. Основным назначением считается очистка от колебаний и соединения разных частей подвески.

    Подобные сайлентблоки можно встретить в двигателе автомобиля, коробке передач, стабилизаторах, амортизаторах и креплениях рычагов. В процессе эксплуатации сайлентблоки подвергаются сильным нагрузкам, в результате за ними нужно следить и вовремя менять. Как показывает практика, замену производить через каждые 50 тысяч километров пробега.

    На первый взгляд это небольшая и несущественная деталь, но копнув глубже, можно понять, что сайлентблоки влияют на работу всей подвески как минимум.В результате износа сайлентблока ухудшается управляемость автомобиля, особенно это ощущается на высокой скорости. Также характерной особенностью поломки является неприятный скрип, крен машины и люфт в рулевом колесе.

    Составные части и расположение


    Сайлентблок - это две подметальные машины из металла с резиновой вставкой. Хотя современные разновидности сайлентблоков по виду могут быть разными. В зависимости от расположения он может быть снаружи с металлической втулкой или полностью резиновым.

    Также в зависимости от конструкции резиновой вставки сайлентблок может отличаться. В зависимости от назначения резиновая вставка может быть цельной, ребристой или вибрирующей. Последние, как правило, устанавливаются в двигателе иномарки, чтобы убрать вибрацию, передаваемую агрегатом на кузов автомобиля.

    Больше всего сайлентблоков можно встретить в передней и задней подвеске, а именно в рычагах. В основном предназначен для удержания подвижных механизмов подвески. Передние сайлентблоки расположены в переднем рычаге, отсюда и название.Именно на них нагрузка больше всего, так как они отвечают за поворотные и движущиеся механизмы автомобиля.

    Задние сайлентблоки хорошо видны на креплениях амортизаторов, в задней подвеске или на реактивной тяге. Везде, где есть телесная нагрузка на ходовую часть или стыковку движущихся частей с неподвижными механизмами.

    Как проверить исправность


    Как правило, сайлентблоки способны выезжать на расстояние до 100 тысяч километров, но специалисты рекомендуют проводить их осмотр после 50 тысяч километров пробега.Чтобы понять, достаточно ли болтался сайлентблок, обычно вождение автомобиля становится вялым, а вращение руля довольно вялым, с большой задержкой.

    После появления таких симптомов стоит осмотреть визуально на предмет повреждений. Все это лучше производить на смотровой яме после мойки машины. На чистых и сухих сайлентблоках будет хорошо видна трещина, прорыв или выброшенная часть резины. Чтобы понять, где неисправность, нужно иметь представление о том, как выглядит новый сайлентблок.Осматривая, также стоит обратить внимание на люфт, который, по сути, должен быть минимальным или вообще отсутствовать.

    Еще одним поводом для проверки целостности сайлентблоков является развал развал или схождение колес. Изначально он будет ровным и отвечать всем необходимым стандартам, но из-за выхода из строя резинометаллических соединений это будет заметно даже в обычном состоянии автомобиля на стоянке. Другими словами, сначала нужно определить причину качественного управления и визуально.

    Сменить сайлентблок автомобиля


    Как только одна из вышеперечисленных причин была обнаружена, стоит немедленно заменить сайлентблок. Самостоятельно провести замену не так-то просто, поэтому на первое время лучше взять помощника, имеющего опыт замены таких деталей.

    Замена передних сайлентблоков не так уж и сложна, для этого нужно поднять машину на домкрате и поворачивать руль можно менять. Если есть возможность полностью снять передний рычаг, то такая процедура замены будет проще и проще.Сам процесс замены не такой сложный, как кажется на первый взгляд, для начала рассмотрим замену на переднем рычаге автомобиля.

    Для снятия старого сайлентблока нужно прогреть ушко рычага горячим воздухом, чтобы резиновая деталь стала мягкой. Боковые части, они же выступы сайлентблоков с ножовкой для облегчения выдвижения. Иногда в зазор между сайлентблоком и проушиной смазывают моторным маслом, чтобы ускорить процесс снятия.


    Для упражнений лучше всего использовать специальный съемник. Если такого съемника сайлентблока нет, то поднимаясь по рычагу с тягой диаметром не больше сайлентблока, выбейте его в обратном направлении. В этом случае рекомендуется смазать моторным маслом, чтобы облегчить работу. Установка или прессование, процесс проще. У опытных водителей свои пути.

    Замена сайлентблоков спереди начинается с:

    • чистки и подготовки ресниц, удаляем образовавшуюся ржавчину и консистенцию, которая могла образоваться в процессе выдавливания;
    • Первый способ нажатия - непосредственно на застежку Mesa переднего рычага.Устанавливаем бортик на один из креплений, затем с одной стороны устанавливаем шайбу большего диаметра, а с другой - болт сайлентблока. Раскручивая и направляя сайлентблок, стягиваем и тем самым прописываем в глаз.
    • Второй вариант - зажав проушину в тисках, установить сверху сайлентблок и с помощью шайбы и болта прижать. Время от времени постукивают по болту молотком.

    В любом из вариантов ценообразования нужно быть внимательным и следить, чтобы не было повреждений резиновой части сайлентблока об острые края проушины.


    При замене задних сайлентблоков процесс опрессовки будет немного отличаться в зависимости от марки и модели автомобиля, хотя на современных машинах процесс практически такой же.

    Например, прижим сайлентблоков задних рычагов осуществляется после установки на место крепления. Вам нужно установить балку задней подвески обратно в автомобиль, вставить болты крепления, которые крепятся к кузову, при этом примеряя и устанавливая сайлентблоки.Направляя в пазы, подогнать автомобиль и затянуть болты, тем самым под тяжестью автомобиля сайлентблоки вдавливаются в проушину.

    Каждый может сказать, что есть другие способы замены и это так. Определенного метода замены нет, и каждый делает его удобным для себя. Следует понимать, что прессование происходит под действием силы и давления. В том случае, когда новый сайлентблок легко ушел на место старого, он должен насторожить.

    Вариант не исключен.

    1. Поврежден рычаг или другая деталь, на которой установлен сайлентблок;
    2. Новый сайлентблок может быть поддельным или неподходящего диаметра;
    3. Повреждена одна из втулок нового сайлент-блока, тогда эластичность детали теряется, и резиновая деталь быстро приходит в негодность.
    Салент-блок рычага автомобиля необходимо внимательно осматривать на предмет повреждений, так как это один из основных составных элементов, отвечающих за подвеску и рулевое управление автомобиля.На низких транспортных средствах автомобиля проблема будет не так заметна, но на высокой скорости будет хорошо ощутимой и непредсказуемой.

    Поэтому замену сайлентблоков рычагов не следует откладывать на потом и при первых проявлениях симптомов стоит провести ремонт.

    Стоимость сайлентблоков рычажных


    В первую очередь цена будет зависеть от материала, из которого изготовлен сайлентблок. Выделяют два типа - это резина с металлическими рукавами и полиуретан.Многие водители скажут, что полиуретан намного лучше, но он стоит на пять дороже, чем резина. Причина такой разницы довольно проста, полиуретановые сайлентблоки легче менять, прессование осуществляется легко и не требует больших усилий. По сроку службы на машине служат раза в 5 больше, чем на резине.

    По ценовой политике многое зависит от марки и модели автомобиля, а также от года выпуска. Например, сайлентблок подушки двигателя Mazda 626 будет стоить 1200 рублей.На шевроле Эпик 2.0 задний верхний рычаг будет стоить около 1150 рублей за 1 шт. Цена указана на резине, полиуретан будет дороже.

    Вывод один, если модель автомобиля не дорогая, и она не часто эксплуатируется, то дорогое толку установить невозможно, а если все наоборот, и часто будете менять (с учетом качества наших дорог ) лучше не экономить на качестве материала и устанавливать сроки, а на качестве.Таким образом удастся сэкономить деньги и время на процессе замены.


    Как только появятся первые симптомы выхода из строя сайлентблоков автомобиля или видно, что развал / установка неправильная установка колес, не спешите ехать на СТО для его регулировки. Сначала осмотрите сайлентблоки на предмет повреждений, и вспомните, когда в последний раз производили замену.

    Видео замены сайлентблоков передних рычагов автомобиля:

    Техническое обслуживание и ремонт ходовой части и подвески - одна из основных сервисных операций, которая абсолютно необходима для обеспечения безопасной эксплуатации автомобиля.Управляемость, маневренность, предсказуемость траектории движения, другие динамические характеристики зависят от функционального состояния комплекта узлов и деталей, в том числе сайлентблоков.

    Сайлентблоки или резинометаллические петли - детали, используемые в качестве упругих элементов узлов крепления шасси и подвесных деталей. Основная задача, возложенная на эту небольшую деталь, - это очистка от ударов и вибрационных колебаний, возникающих между элементами шасси и деталями подвески. Есть два типа сайлентблоков - передний и задний.Первые устанавливаются между узлами передней подвески (стабилизаторы, рычаги, амортизаторы), а вторые - на задней оси. Стоит отметить, что сайлентблоки, как и виброизоляторы, используются в системе крепления двигателя и коробки передач.

    Ресурс и признаки неисправностей сайлентблока

    Все детали и элементы автомобиля требуют постоянной проверки, своевременного обслуживания и ремонта. Не составляют исключение и резинометаллические петли. Срок службы сайлентблоков рассчитан примерно на 100-150 тысяч км пробега, но интенсивная эксплуатация автомобиля на дорогах с плохим покрытием значительно снижает ресурс этих элементов.Основными признаками, свидетельствующими о необходимости замены сайлентблоков, являются:

    • Разрушение (растрескивание) резиновых втулок
    • Чрезмерный люфт в резиновой мельнице
    • потеря курсовой устойчивости (прикрытие автомобиля из стороны в сторону)
    • Защита шин от неравномерного бокового износа
    • экраны и шум при движении

    Функциональное состояние шарниров передней и задней подвески рекомендуется проверять не реже одного раза в год или каждые 50 000 км пробега.Стоит учесть, что взвешенная и аккуратная манера вождения положительно сказывается на сроке службы всех без исключения деталей подвески и ходовой части.

    Замена сайлентблоков

    Перед тем, как произвести замену сайлентблоков, необходимо определить, какие именно соединения требуют ремонта. Для диагностики автомобиля подвешивание на подъемнике и осмотр соединений элементов шасси и подвески на предмет шумихи и повреждений.Замена поврежденных шарниров осуществляется с помощью штатного сантехнического инструмента, специального приспособления для прижатия сайлентблоков к штатным сиденьям, а также съемников рулевых и шаровых опор.

    Наибольшую сложность представляет замена сайлентблоков в узлах крепления силового агрегата и КПП. Эту трудоемкую операцию желательно проводить исключительно на СТО, где все необходимое оборудование и работы проводят профессионалы высокого уровня.

    Важно помнить, что после замены сайлентблоков или любой другой операции, затрагивающей элементы шасси и подвески, углы развала колес регулировались.

    Как заменить сайлентблок своими руками видео

    Синаптически молчаливые сенсорные волосковые клетки у рыбок данио набираются после повреждения

    Разведение рыбок данио и штаммы

    Рыбок данио ( Danio rerio ) выращивали при 30 ° C с использованием стандартных методов.Личинок выращивали в среде зародыша E3 (5 мМ NaCl, 0,17 мМ KCl, 0,33 мМ CaCl 2 и 0,33 мМ MgSO 4 , pH 7,2). Работа с рыбками данио, выполненная в Национальном институте здоровья (NIH), была одобрена Комитетом по использованию животных в NIH в соответствии с протоколом исследования на животных № 1362-13. Личинок исследовали через 2–6 дней после оплодотворения (dpf), если не указано иное. В этом возрасте пол невозможно предсказать или определить, поэтому в наших исследованиях пол животного не рассматривался. Ранее описанные мутантные и трансгенные штаммы рыбок данио, использованные в этом исследовании, включают: Tg (-6myo6b: GCaMP6s-CAAX) idc1Tg , Tg (-6myo6b: Ribeye b-mCherry) (-6myo6b: RGECO) vo10Tg , и TgBAC (нейрод: GFP) nl1 13,60 .

    Для устранения эфферентных и афферентных нейронов, которые иннервируют невромасты задней боковой линии, мы использовали морфолиноантисмысловой олигонуклеотид (MO, Gene Tools) против neurog1a 24 . Использовали стартовый кодон MO для neurog1a : MP-5'ATCGGAGTATACGATCTCCATTGTT3 '. МО разводили в воде и 1 нл 900 мкМ раствора вводили в 1-клеточные эмбрионы. При этой концентрации ~ 50% личинок морфанта neurog1a не имели акустической реакции испуга на 5 день, что согласуется с отсутствием афферентной иннервации.После функциональной визуализации для подтверждения отсутствия иннервации использовали иммунную метку (см. Ниже).

    Конструирование вектора и создание трансгенных линий

    Конструирование плазмиды было основано на наборе рыбок данио tol2 / gateway 61 . Входной клон p5E pmyo6b 9 использовали для управления экспрессией в волосковых клетках, а энхансер SILL1 12 в клоне p3E использовали для управления экспрессией в афферентных нейронах. Для этого исследования мы создали pME- SypHy из конструкции SypHy, предоставленной Леоном Лагнадо 17 , pME- jRCaMP1a-CAAX из клона Addgene # 61532 62 и pME-Bongwoori из клона Addgene203 63 .Клон pME- GCaMP6s-caax был ранее описан 13 . Эти клоны использовали вместе со следующими шлюзовыми клонами набора tol2 p5E- hsp70l (# 222), p3E- 2A-nlsmCherrypA (# 766), p3E-polyA (# 302) и pDest (# 395), чтобы создать экспрессионные конструкции: myo6b: SypHy, myo6b: jRCaMP1a-CAAX, hsp70l: GCaMP6s-CAAX -SiLL1 и myo6b: Bongwoori-2A-nlsmCherry . Для создания стабильных трансгенных рыбных линий Tg (-6myo6b: SypHy) idc6Tg , Tg (-6myo6b: jRCaMP1a-caax) idc7Tg 16, Tgl70: idc8Tg и Tg (-6myo6b: Bongwoori-2A-nlsmCherry idc9Tg , плазмидную ДНК и мРНК транспозазы tol2 инъецировали в 61 эмбрионы рыбок данио, как описано ранее 907.

    Иммуногистохимия и конфокальная визуализация

    Иммуногистохимия была проведена на целых личинках. Личинки рыбок данио фиксировали 4% параформальдегидом в PBS в течение 4,5–6 ч при 4 ° C. После промывок 5 × 5 мин в PBS + 0,01% твин (PBST) и 5-минутной промывки в H 2 O личинки были проницаемы ледяным ацетоном (при -20 ° C) в течение 5 минут. Затем личинок промывали в H 2 O в течение 5 минут, затем промывали 5 × 5 минут в PBST, а затем блокировали в течение ночи буфером PBS, содержащим 2% козьей сыворотки и 1% бычьего сывороточного альбумина (BSA).Первичные антитела разводили (см. Ниже) в буфере PBS, содержащем 1% BSA, и личинок инкубировали в растворе в течение 3 часов при комнатной температуре. После 5 × 5-минутной промывки PBST для удаления первичных антител разбавленные вторичные антитела (1: 1000) связаны с Alexa 488 (# A21121, # A21131, # A21467), Alexa 568 (# A21133, # A11010) или Alexa 647. (# A21241, # A21242) (ThermoFisher Scientific, MA) добавляли в буфер PBS, содержащий 1% BSA, и инкубировали в течение 2 часов при комнатной температуре. После 5 × 5-минутной промывки в PBST для удаления вторичных антител личинок промывали в H 2 O и помещали в Prolong gold (ThermoFisher Scientific, MA).

    В этом исследовании были использованы следующие антитела:

    anti-Vglut3 (1: 1000, кролик) метят синаптические везикулы волосковых клеток, подарок Терезы Николсон 60 anti-Vamp2 (1: 500, кролик, Genetex, # GTX132130) маркирует все эфферентные пресинапсы волосковых клеток

    anti-Ribeye b (1: 10,000, мышиный IgG2a) маркирует пресинаптические ленты волосковых клеток, подарок Терезы Николсон 64

    anti-Ca V 1.3a ( 1: 1000, кролик) маркирует пресинаптический Ca 2+ каналов волосковой клетки, подарок Терезы Николсон 64

    антитело против пан-MAGUK (1: 500, мышиный IgG1 NeuroMab, K28 / 86, № 75– 029) маркирует постсинаптические плотности

    анти-Ace-тубулин (1: 5000, мышиный IgG2b, Sigma, # T7451) маркирует афферентные отростки и волосковые клетки

    анти-TH (1: 1000, мышиный IgG2a, Vector labs, # VP- T489) маркирует дофаминергические эфференты

    анти-ChAT (1: 500, козий, Millipore, # AB144P) маркирует холинергические эфференты.

    В боковой линии рыбок данио, помимо афферентных нейронов, по крайней мере два типа эфферентных нейронов иннервируют невромасты: один является дофаминергическим, а другой предположительно холинергическим 8,21,22,23 . И ChAT (холинергические), и TH (дофаминергические) антитела маркируют эфферентные нейроны, иннервирующие невромасты боковой линии (дополнительный рис. 6a, c). Антитело Vamp2 маркирует пресинапсы в обоих эфферентах (Fig. 4e, f и Supplementary Fig. 6a-d). Ацетилированный тубулин окрашивает афферентные процессы (рис.4e, f и дополнительный рис. 6g, h). Иммуно-метка ацетилированного тубулина колокализуется с трансгеном нейрод : GFP , который, как было показано ранее, экспрессируется в афферентных нейронах, иннервирующих боковую линию 60 (дополнительный рис. 6e, g, h). Основываясь на этих окрашиваниях, Vamp2 и ацетилированный тубулин использовали в комбинации для проверки наличия или отсутствия эфферентных или афферентных процессов, соответственно, у морфантов neurog1a (рис. 4e, f).

    SypHy представляет собой pH-чувствительный GFP, слитый с маркером синаптических везикул Synaptophysin 17 .Чтобы подтвердить локализацию SypHy в синаптических пузырьках в волосковых клетках, SypHy трансгенных рыб иммуноокрашивали маркером синаптических пузырьков Vglut3 вместе с Ribeye b (Supplementary Fig. 4a-d). Чтобы подтвердить наличие пре- и постсинаптической специализации волосковых клеток после визуализации SypHy, рыб иммуноокрашивали пресинаптическим Ribeye b и постсинаптическим MAGUK (дополнительный рис. 4i, j). конфокальный микроскоп с размером 63 × 1.Линза масляного объектива 4 NA; 488 нм использовали для возбуждения Alexa 488, SypHy или GFP; 546 нм для Alexa 568; и 647 нм для Alexa 647. Для количественных измерений параметры конфокального изображения, включая усиление, мощность лазера, скорость сканирования, время задержки, разрешение и масштабирование, поддерживались между сравнениями. Параметры микроскопа регулировались по самому яркому контрольному образцу. Для анализа изображений были созданы и проанализированы максимальные проекции конфокальных изображений z-стека с помощью ImageJ 65 .Изображения, содержащие иммунную метку, были скорректированы на фон с использованием метода коррекции катящегося шарика.

    Для живых изображений трансгенных рыб на дополнительном рис. 1 изображения были получены на вертикальном лазерно-сканирующем конфокальном микроскопе Nikon C2 с использованием водяного объектива с числовой апертурой 60 × 1.0. Соответствующие твердотельные лазеры использовались для изображения и возбуждения EGFP, GCaMP6s, RGECO, SypHy, mCherry, jRCaMP1a или Bongwoori.

    Фармакология

    Все препараты были приготовлены во внеклеточном растворе с 0.1% ДМСО (за исключением того, что ДМСО не использовали с BAPTA). Для экспериментов по визуализации раствор водоструйной микропипетки также заменяли внеклеточным раствором, содержащим лекарство. Все препараты были приобретены у Sigma-Aldrich, за исключением BAPTA, который был приобретен у Thermo Fisher Scientific.

    Используемые препараты включают: исрадипин, Bay K 8644, FFA, 1-гептанол, 6,7-динитрохиноксалин-2,3-дион (DNQX), T16 (inh) -A01 и 1,2-бис (2-аминофенокси). ) этан- N , N , N ′, N ′ -тетрауксусная кислота (БАПТА).В таблице 1 перечислены концентрации и продолжительность инкубации препаратов, использованных в этом исследовании.

    Таблица 1 Фармакологические соединения, использованные в исследовании

    Электронная микроскопия

    Личинок готовили для электронной микроскопии, как описано ранее 13 . Вкратце, на 4 день дикого типа или Tg (-6myo6b: Ribeye b-mCherry) idc3Tg личинок фиксировали в свежеприготовленных 4% параформальдегиде и 2% глутаральдегиде (электронная микроскопия) в 0.1 М фосфатный буфер pH 7,4 в течение 30 мин при комнатной температуре с последующей 2-часовой инкубацией при 4 ° C. После фиксации личинок промывали 0,1 М какодилатным буфером, затем фиксировали в 2% -ном глутаральдегиде в течение 15 мин и промывали 0,1 М какодилатным буфером. Затем личинок помещали в 1% тетроксид осмия в 0,1 М какодилатном буфере на 30 мин, а затем промывали 0,1 М какодилатным буфером, дегидратировали в этаноле, включая уранилацетат в 50% этаноле, а затем в оксид пропилена, а затем помещали в Эпон.Поперечные серийные срезы (тонкие срезы ~ 60 нм) использовали для сечения невромастов. Большинство срезов помещали на сетки с одинарными прорезями, покрытые углеродом и формваром (EMS), а затем срезы окрашивали уранилацетатом и цитратом свинца. Образцы получали на электронном микроскопе JEOL JEM-2100 (JEOL Inc.).

    Щелевые соединения были идентифицированы по установленным критериям для стандартной ПЭМ: две клеточные мембраны, выровненные параллельно и относительно прямые, с межклеточным зазором 2–3 нм (~ 5 нм, включая внешние окрашенные листочки двух клеточных мембран) 25,27 , 66,67 .Внешний вид опубликованных при большом увеличении субструктуры щелевого соединения варьируется и зависит от фиксации, внедрения, секционирования, окрашивания и визуализации 66,67 . Мы исследовали все волосковые клетки и опорные клетки на срезах, ища щелевые соединения между клетками по их сторонам или основаниям. Щелевые соединения, которые мы идентифицировали в невромастах, по-видимому, идентичны по тонкой субструктуре тем, которые обнаруживаются между поддерживающими клетками вестибулярного или слухового эпителия позвоночных 25,26,27,68 .Мы не обнаружили щелевых соединений между волосковыми клетками и опорными клетками, а также не обнаружили щелевых соединений между афферентными и эфферентными нервными отростками. Щелевые соединения были относительно редкими - например, в одном эксперименте, где мы исследовали 29 срезов 4 невромастов от двух личинок дикого типа, мы обнаружили 7 щелевых соединений; для 2 из этих 7 щелевые переходы были обнаружены на 2-х и 3-х последовательных участках соответственно.

    Подготовка образцов и стимуляция для функциональной визуализации

    Чтобы подготовить личинок при 2–6 dpf для функциональной визуализации, отдельные личинки сначала анестезировали трикаином (0.03% этил-3-аминобензоатметансульфонатная соль, Sigma). Для более старых личинок при 13 dpf (рис. 2h) личинок инкубировали с трикаином и обезглавливали лезвием бритвы. Затем целые или обезглавленные личинки были прикреплены к записывающей камере, заполненной Sylgard. Для подавления движения интактных личинок в сердце вводили альфа-бунгаротоксин (125 мкМ, Tocris). Затем личинок промывали раствором внеклеточной визуализации (в мМ: 140 NaCl, 2 KCl, 2 CaCl 2 , 1 MgCl 2 и 10 HEPES, pH 7.3, OSM 310 ± 10) без трикаина и дали восстановиться. Стимуляция волосковых клеток невромаста осуществлялась струей жидкости. Струя жидкости состояла из прижимного зажима (HSPC-1, ALA Scientific), прикрепленного к стеклянной пипетке (внутренний диаметр наконечника ~ 30–50 мкм). Стеклянную пипетку заполняли внеклеточным раствором и использовали для механической стимуляции апикальных пучков волосковых клеток вдоль передне-задней оси рыб 9 . Мы использовали струю жидкости, чтобы стимулировать две полярности волосковых клеток, применяя передний или задний направленный стимул отдельно (дополнительный рис.3а – в, д – ж). В качестве альтернативы мы использовали 2-секундный чередующийся передне-задний направленный стимул длительностью 5 Гц в виде прямоугольной волны для одновременной стимуляции всех волосковых клеток в рамках одного и того же испытания (дополнительный рис. 3a, d, e, h). Мы получили аналогичные результаты с обеими парадигмами стимулов. Отклонение апикального пучка волос отслеживали, измеряя расстояние смещения кончиков пучков, киноцилий. Для 2-секундного отклонения (шаг или 2-х 5 Гц) мы обнаружили, что, когда киноцилиальные кончики отклонялись более чем на 5 мкм, величина апикальных и пресинаптических сигналов GCaMP6s Ca 2+ была насыщена.В пределах киноцилиальных расстояний отклонения 1–5 мкм сигналы Ca 2+ увеличивались с увеличением расстояния отклонения, а сигналы Ca 2+ не были насыщенными. Интенсивные отклонения пучков, которые перемещают киноцилиальные кончики более чем на 10 мкм, обычно вызывают артефакты движения и повреждают пучки волос. В соответствии с повреждением, после интенсивных отклонений пучка 10 мкм последующие ответы Ca 2+ резко уменьшились. Расстояние отклонения 5 мкм использовалось в большинстве наших экспериментов для достижения максимальных сигналов Ca 2+ .Для рис. 1 и для измерения корреляции между апикальными и пресинаптическими сигналами Ca 2+ использовали расстояние киноцилиального смещения 2 мкм, чтобы гарантировать, что апикальный и пресинаптический ответы Ca 2+ оставались ненасыщенными. Для обнаружения афферентных сигналов Ca 2+ более короткий стимул 200 мс (рис. 3e) обеспечивал более точные постсинаптические считывания по сравнению с более длинным стимулом 2 с (рис. 3l). Во время более длительных стимулов постсинаптические сигналы Ca 2+ распространяются от мест их происхождения - смежных с лентами - на весь афферентный процесс.Во время более длительных стимулов активные постсинаптические сайты определялись началом стимула. Чтобы координировать стимуляцию с получением функционального изображения, зажим давления приводился в действие командой скачка напряжения во время получения. Исходящий сигнал напряжения от программного обеспечения для обработки изображений (Prairie view или Nikon Elements) использовался для координации получения изображения со стимулом зажима давления.

    Для функциональной визуализации до и после декапитации (рис. 4a – d) мы сначала проанализировали пресинаптические ответы Ca 2+ перед декапитацией личинок рыбок данио.Затем мы обезглавили рыбу лезвием бритвы и повторно стабилизировали оставшееся тело рыбы с помощью булавок. В течение 20 минут мы повторно проанализировали пресинаптические ответы Ca 2+ , применив ту же стимуляцию.

    Для экспериментов с GCaMP6s с использованием приложения с высоким содержанием K + для деполяризации волосковых клеток струю жидкости использовали для механической стимуляции волосковых клеток и идентификации активных волосковых клеток. Затем животных обрабатывали BAPTA для расщепления внеклеточных связей между стереоцилиями (концевые связи 69 ), необходимых для блокировки каналов механочувствительных ионов (см. Дополнительные меры контроля ниже) и отмены механочувствительной функции.После обработки BAPTA струя жидкости больше не могла механически генерировать детектируемые пресинаптические ответы Ca 2+ в волосковых клетках (фиг. 6g). Затем раствор внутри струи жидкости заменяли 1 М KCl и располагали на расстоянии 100 мкм от невромаста. Направленный вперед поток K + применялся в течение 6 с во время сбора GCaMP6s для получения высокого K + ; 1 M K + был необходим для проникновения через кожу и поддерживающие клетки, чтобы активировать волосковые клетки во время временного окна стимула в нашем неповрежденном препарате.Для экспериментов по визуализации напряжения Bongwoori обработка BAPTA и стимул с высоким K + выполнялись аналогичным образом.

    Проверка специфичности генетически закодированного индикатора

    Чтобы подтвердить, что апикальные, механочувствительные ответы Ca 2+ , обнаруженные с использованием myo6b: GCaMP6s-CAAX , были вызваны не артефактами движения, а активностью механочувствительных ионных каналов, присутствующих в Для снятия механочувствительности мы применили БАТТА.Это устраняет механочувствительные ответы Ca 2+ на вершине, а также пресинаптические ответы Ca 2+ в основании (Supplementary Fig. 2a-e). Чтобы подтвердить, что пресинаптические ответы Ca 2+ в основании волосковой клетки зависят от Ca V 1.3, мы применили антагонист каналов Ca 2+ L-типа исрадипин. Исрадипин устраняет все пресинаптические ответы Ca 2+ в основании волосковой клетки, не влияя на апикальные механочувствительные сигналы (дополнительный рис.2f – j).

    Чтобы проверить специфичность афферентных ответов Ca 2+ , обнаруженных с использованием hsp70l: GCaMP6s-CAAX-SiLL1 , мы применили DNQX, антагонист рецептора AMPA, поскольку недавняя работа показала, что Ca 2+ -проницаемые рецепторы AMPA необходимы для постсинаптических ответов Ca 2+ в синапсах волосковых клеток 70 . После применения DNQX количество волосковых клеток, связанных с постсинаптической активностью Ca 2+ , значительно уменьшилось (рис.3е).

    SypHy - это pH-чувствительный GFP, локализованный в синаптических пузырьках. Внутри синаптических везикул SypHy подкисляется, и его флуоресценция гасится, но при слиянии с плазматической мембраной SypHy нейтрализует кислотность и усиливает флуоресценцию. Чтобы подтвердить, что SypHy правильно подкислен и готов к обнаружению слияния везикул во всех клетках, внеклеточный раствор был заменен аналогичным раствором, содержащим 40 мМ NH 4 Cl (40 мМ NaCl было удалено для поддержания осмолярности), чтобы нейтрализовать и ослабить SypHy. .Базовые сигналы SypHy получали с помощью вертикального лазерного сканирующего конфокального микроскопа Nikon C2 с использованием водяного объектива с числовой апертурой 60 × 1.0 до и после 10–20 мин нанесения 40 мМ NH 4 Cl. ImageJ 65 использовался для вычитания фона и количественной оценки изменений интенсивности до и после раскисления. По сравнению с исходным сигналом SypHy все волосковые клетки показали повышенный сигнал SypHy после нанесения NH 4 + (дополнительный рис. 4e – g), что указывает на то, что SypHy был должным образом подкислен во всех волосковых клетках.

    Функциональная визуализация

    Для визуализации Ca 2+ -зависимой механочувствительности, пресинаптического Ca 2+ , цитозольного Ca 2+ , афферентного Ca 2+ , слияния везикул SypHy и изменений напряжения Bongwoori мы использовали два системы микроскопов: конфокальная система Bruker Swept-field и вертикальный моторизованный Ni-E микроскоп Nikon ECLIPSE, работающий как в широкопольном, так и в конфокальном режимах визуализации. Система Bruker Swept-field использовалась для всех волосковых клеток SypHy, RGECO1, jRCaMP1a, визуализации Bongwoori и большинства пресинаптических изображений GCaMP6s Ca 2+ , а также всех афферентных изображений GCaMP6s (рис.1–6, дополнительные рис. 2–7). Широкопольная и конфокальная система Nikon использовалась для пресинаптической визуализации GCaMP6s до и после лазерного повреждения (рис. 7).

    Конфокальная система Bruker Swept-field была оборудована камерой Rolera EM-C2 CCD (QImaging) и иммерсионным объективом Nikon CFI Fluor 60 × 1.0 NA. Мы использовали набор двухполосных фильтров 488/561 нм (59904-ET, Chroma). Система находилась под управлением компании Prairie View (Bruker Corporation). Получение изображений в одной плоскости было выполнено для всех изображений волосковых клеток SypHy, RGECO1, jRCaMP1a и Bongwoori с частотой кадров 10 Гц с биннингом 2 × 2.Данные визуализации SypHy были получены в трех отдельных плоскостях на расстоянии 2 мкм друг от друга, которые были объединены для анализа. Одновременное отображение активности Ca 2+ на всех пре- или постсинаптических участках с использованием GCaMP6 в волосковых клетках или афферентных процессах по оси Z осуществлялось с помощью пьезоэлектрического двигателя (серия PICMA P-882.11-888.11, инструменты PI), прикрепленного к Цель состоит в том, чтобы обеспечить быстрое получение изображений в пяти плоскостях по оси Z с интервалами 2 мкм, с частотой кадров 50 Гц, что дает объемную частоту 10 Гц.Пять плоских Z-стопок проецировали в одну плоскость для дальнейшей обработки изображений и количественной оценки. Для анализа сигналов Ca 2+ , локализованных на ленте, для количественной оценки использовалась только плоскость, содержащая ленты (рис. 1h, i).

    Двухцветная визуализация RGECO1 и SypHy или GCaMP6s была выполнена с использованием делителя луча Dual-View (Photometrics) со следующими фильтрами: дихроичный 565; зеленая эмиссия 520/30; красное излучение 630/50 (цветность) для спектрального разделения индикаторов и обеспечения возможности двойного отображения зеленого и красного сигналов.Данные визуализации RGECO1 и SypHy или GCaMP6s получали последовательно. Сначала была получена одна центральная плоскость визуализации RGECO1 (рис. 3h, дополнительный рис. 5b). Затем были получены три отдельные плоскости визуализации SypHy и GCaMP6s на расстоянии 2 мкм друг от друга (рис. 3i и дополнительный рис. 5c) с помощью светоделителя. Последние три самолета были спроектированы для анализа.

    Эксперименты по лазерному повреждению

    Для экспериментов по лазерному повреждению использовался Ni-E микроскоп Nikon ECLIPSE. Для этих экспериментов измерения пресинаптического Ca 2+ GCaMP6 волосковых клеток регистрировали с использованием либо широкоугольной камеры ORCA-D2 (Hamamastu Photonics) (рис.7) или конфокальные ФЭУ C2, управляемые с помощью программного обеспечения Elements (Nikon Instruments Inc.). Для получения изображений с помощью GCaMP6s с широким полем микроскоп был оснащен следующим набором фильтров: возбуждение: 480/30 нм и испускание: 535/40 нм, с биннингом 2 × 2. Для конфокальной системы C2 GCaMP6s возбуждали твердотельным лазером с длиной волны 488 нм. Для обоих методов визуализации использовался водно-иммерсионный объектив CFI Fluor 60 × 1.0 NA, а функциональная визуализация Ca 2+ выполнялась при 6–10 Гц. После стимуляции для определения активных волосковых клеток в Nikon Elements сфокусированная точка ROI помещалась на ядро ​​одной активной клетки.Повреждение волосковых клеток осуществляли лазером с длиной волны 405 нм, сфокусированным на точку ROI при 100% мощности лазера, со скоростью сканирования 8 мс в течение 1,5–2 с. Эта интенсивность повреждения была выбрана потому, что она находится на пороге инактивации, но повреждение не повлияло явно на какие-либо клеточные структуры. Например, длительность лазерного повреждения 405 нм, равная 1,0 с, была недостаточна для инактивации волосковой клетки. Мы определили успешное лазерное повреждение как поврежденную клетку, которая все еще присутствовала, но больше не реагировала на пресинапсию (пример, клетка 1 на рис.7б, д). После повреждения активной волосковой клетки орган рестимулировали и оценивали через 10–30 мин после лазерного повреждения.

    K

    + измерения концентрации

    Краситель Asante Potassium Green-2 (APG-2, Kd = 18 мМ, TEFLabs) был использован для измерения относительного [K + ] в уровнях в волосковых клетках и поддерживающих клетках. . В отличие от многих жизненно важных красителей, APG-2 не проникает в волосковые клетки через механочувствительные каналы. Чтобы пометить волосковые клетки APG-2, мы вводили 100 мкМ APG-2 в сердце вместе с альфа-бунгаротоксином, используемым для паралича личинок.Затем личинок купали во внеклеточном растворе в течение 30 минут, чтобы краска пометила волосковые клетки перед визуализацией. Дальнейшее время инкубации не привело к дополнительному окрашиванию. APG-2 получали на конфокальном микроскопе Nikon C2 (см. Выше) с использованием 488-нм лазера. Для визуализации волосковых клеток Ca 2+ с использованием jRCaMP1a и последующего мечения APG-2 личинки были подготовлены для пресинаптической визуализации Ca 2+ , как описано выше для GCaMP6, с использованием нашей конфокальной системы с развернутым полем. Линия jRCaMP1a привела к значительно меньшему спектральному переходу в зеленый канал по сравнению с RGECO1.Устранение проступания было особенно важно при выполнении двухцветного изображения с относительно тусклым красителем APG-2. После функциональной визуализации jRCaMP1a личинкам в сердце вводили 100 мкМ APG-2 и повторно визуализировали через 30 минут на конфокальном микроскопе Nikon C2. ImageJ 65 использовался для вычитания фона и количественной оценки интенсивности APG-2.

    Функциональная регистрация и обработка изображений

    Необработанные изображения были обработаны с помощью специальной программы с удобным графическим интерфейсом пользователя в MATLAB R2014 (MathWorks).Сначала мы удалили первые 10 изображений, чтобы уменьшить эффект фотообесцвечивания. Затем необработанные изображения были зарегистрированы для уменьшения артефактов движения путем применения эффективной регистрации субпиксельного изображения на основе взаимной корреляции 71 . Процедура получения и наложения пространственного распределения сигнала в виде тепловых карт была описана ранее 14 . Вкратце, мы сначала вычислили базовое изображение (или эталонное изображение) путем усреднения изображений за весь период перед стимулом, пиксель за пикселем (примерно 20 кадров).Затем базовое изображение ( F 0 ) было вычтено из каждого полученного изображения, а затем каждое изображение было разделено на F 0 для создания изображений, которые представляют относительное изменение флуоресцентного сигнала от базовой линии или ∆ F / Ф 0 . Чтобы лучше визуализировать изменения интенсивности флуоресценции во время стимуляции, изображения сигналов ∆ F / F 0 за период стимула усреднялись, масштабировались и кодировались цветными картами с синим цветом, указывающим на уменьшение интенсивности сигнала в волосковых клетках Bongwoori. изображение, а красный цвет указывает на увеличение интенсивности сигнала для всех остальных индикаторов.Для каждого индикатора (и для каждого микроскопа) мы определили минимальный уровень шума - значение, выше которого мы могли бы надежно отличить сигнал от шума, - и последовательно использовали это значение в наших рисунках. Минимальный уровень шума помог установить начальное значение для наших цветных карт ∆ F / F 0 . Затем цветные карты накладывались на усредненные исходные исходные изображения в градациях серого, чтобы легко визуализировать пространственные изменения интенсивности флуоресценции во всех волосковых клетках или афферентных процессах в нейромасте во время стимуляции.Для данных, представленных на рисунках, среднее относительное изменение флуоресцентного сигнала в течение всего периода стимуляции отображается как «стимул».

    Количественная оценка функциональной визуализации

    Для слияния везикул SypHy, пресинаптических GCaMP6s и jRCaMP1a, цитозольного RGECO1 и афферентных GCaMP6s Ca 2+ измерений была помещена круглая ROI диаметром ~ 3 мкм (12 пикселей с 268 нм на пиксель). каждая волосковая клетка в невромасте. Для Bongwoori, датчика напряжения, круглая область интереса диаметром ~ 5 мкм использовалась для лучшего включения клеточной мембраны, где изменения напряжения были ограничены.Для измерений пресинаптических GCaMP6, локализованных в пучках волос и на ленте, круговая область интереса диаметром ~ 1,5 мкм помещалась в центр отдельного пучка или ленты. Расположение ленты определялось либо одновременным (с использованием разделителя двойного обзора, см. Выше), либо последующим захватом изображений лент с меткой Ribeye-mCherry. Сигналы, локализованные на ленте (рис. 1h), измерялись только в плоскости ленты, а не в проекции z-стопки, содержащей все ленты. После выбора области интереса мы вычислили и нанесли на график среднюю интенсивность (∆ F / F 0 ) в каждой области интереса в течение периода записи.Графики временных сигналов были сглажены с помощью трехточечной прокрутки данных, чтобы уменьшить вызванные шумом колебания, при этом максимизируя исходную точность синхронизации. Величину сигнала определяли как максимальное значение изменения интенсивности при стимуляции.

    Статистический анализ

    Все данные были нанесены на график с помощью Prism 7 (Graphpad). Значения в тексте и данных с полосами ошибок на графиках и в тексте выражены как среднее ± SEM. Все эксперименты проводились минимум на трех животных, пяти невромастах и ​​в два независимых дня.Для каждого невромаста мы отобрали примерно 8 (день 2), 16 (день 5) и до 20 (день 13) волосковых клеток (рис. 2h, правая ось Y). Этих чисел было достаточно, чтобы обеспечить статистическую мощность, чтобы избежать ошибок как типа I, так и типа II. Никакие животные или образцы не были исключены из нашего анализа, если контрольные эксперименты не оказались неудачными - в этих случаях все образцы были исключены. В наших исследованиях на животных не использовалась рандомизация или ослепление. В соответствующих случаях наборы данных подтверждались на предмет нормальности с помощью комплексного теста Д’Агостино-Пирсона на нормальность, а для равных дисперсий - с помощью теста F для сравнения дисперсий.Поправка Уэлча использовалась, если выборки не имели одинаковых дисперсий. Статистическая значимость между двумя условиями определялась либо парными, либо непарными, двусторонними тестами Стьюдента t , критерием Манна-Уитни или ранговым критерием пар Уилкоксона, в зависимости от ситуации. Для сравнения нескольких условий использовался односторонний дисперсионный анализ ANOVA с тестом Тьюки для корректировки множественных сравнений.

    Доступность кода

    Matlab R2014 использовался для обработки данных функциональной визуализации, и код доступен по запросу.

    Доступность данных

    Данные, подтверждающие выводы этого исследования, можно получить у соответствующего автора по разумному запросу.

    Что такое подушка двигателя? Что такое подушка (опора) для двигателя и что им нужно какая подушка

    Двигатель подушек двигателя зависит от того, как долго двигатель будет работать, а также от износа кузова кузова. Если подушка порвалась или местами стерлась, ее следует заменить, не теряя времени.Но как я могу узнать, в каком он состоянии? Конечно, вы можете обратиться в автосервис, где вашу машину осмотрят и скажут, в каком состоянии находятся подушки, и стоит ли их менять. Но учтите, что часто работники автосервиса преувеличивают масштаб проблемы или даже изобретают себя с единственной целью - получить большую прибыль. Даже если в конце вы скажете, что не нужно менять ни одной подушки двигателя, проверка тоже платная.Именно поэтому вам лучше придумать, как самостоятельно без лишних затрат проверить подушки двигателя.

    Кстати, если у вас усилилась вибрация в момент запуска / выключения двигателя, то это может свидетельствовать о износе подушек. Если игнорировать этот симптом, он может перерасти в большую проблему, например, привести к деформации тела и подвешиванию.

    Что для этого нужно

    Для проверки вам потребуется:

    • гидравлическое или другое имеющееся у вас;
    • какая-нибудь защитная опора, например, деревянный брус или что-нибудь еще;
    • рычаг - для этого отлично подойдет мята или крепкая палка.

    Порядок проверки

    1. Рассчитать машину с предварительно разобранным гаражом или на платформе с гладким половым покрытием.
    2. Поднимите автомобиль, установив домкрат под одно из передних (а если у вас задний двигатель - заднее) колесо.
    3. Поставить имеющуюся опору для двигателя так, чтобы снять нагрузку с опоры двигателя. Убедившись в надежности опоры, опускаем домкрат.
    4. Используя подпапку или что-нибудь еще, залезьте под машину и начните осмотр подушки двигателя.

    Вы можете обнаружить визуально:

    • трещины и разрывы резины;
    • , что резинка взорвалась;
    • смелая подушка.

    Однако может оказаться, что визуально вы не определили ни одной из возможных проблем. В этом случае можно проверить места крепления двигателя к кузову или передней балке автомобиля на наличие люфта. Для этого достаточно отклонить двигатель в разные стороны, используя в качестве рычага рукоять / крепление.Если люфта не обнаружено, то успокойтесь: подушки двигателя в порядке.

    Если люфт присутствует, а особенно если он ощутимый (двигатель ходит из стороны в сторону), то необходимо будет от него избавиться. Для этого необходимо будет снова установить домкрат и поднять автомобиль, после чего снять страховочную опору с двигателя. Проверьте, хорошо ли затянута опора двигателя. В противном случае затяните его гаечным ключом или трещоткой.

    Самостоятельная замена

    Если визуальный осмотр выявил проблемы с подушкой, ее следует как можно скорее заменить.Начните с покупки новой детали. Следует отметить, что эту запчасть на разборке лучше не покупать, даже если она в хорошем состоянии. В этом случае экономия денег может принести больше вреда, чем пользы. В идеале купил бы оригинальную деталь.

    1. . Поднимите машину на высоту, которая даст доступ к двигателю снизу. При этом в качестве опоры можно использовать домкрат и деревянные бруски.
    2. Поднимите двигатель домкрата, чтобы освободить его, загружает нужную деталь.
    3. Откручиваем болты крепления подушки к двигателю и кузову.
    4. Установите новую запчасть на место, направляя ее следующим образом. Хорошо затяните болты крепления. Их лучше затягивать при работающем двигателе, чтобы избежать чрезмерной вибрации в будущем.
    5. Закончив установку подушки, установите все демонтированные детали на место.

    В каждом случае может быть так, что нет удобного доступа для замены детали. В этом случае попробуйте удалить те узлы, которые мешают вам заменить.

    Иногда для этой операции может потребоваться участие другого человека, который поможет, направляя двигатель, пока вы вставите этот элемент на место.Если речь идет о верхней подушке, то, как правило, осмотреть ее не составит труда, а при необходимости заменить. Можно будет обойтись без ямы.

    Периодически проверяйте, в каком состоянии находятся подушки двигателя вашего автомобиля. Как видите, это совсем не сложно, однако может помочь предотвратить многие проблемы в будущем и обеспечить комфортную езду в любых условиях. Помните, что машина чувствует, когда за ним ухаживают, а потом благодарит хозяина за долгое и хорошее обслуживание.

    Фото инструмент

    Видео

    Подушка двигателя Volvo может быть проверена следующим образом:

    Опора двигателя (подушка двигателя) предназначена для уменьшения вибрационных нагрузок и колебательных движений в пространстве субуправления, а также минимизации передачи таких нагрузок на кузов автомобиля.
    Другими словами, двигатель крепится к несущим элементам кузова автомобиля не напрямую, а с помощью специальных опор, которые еще называют подушками.

    Если просто, то подушка двигателя представляет собой прокладку между двигателем и корпусом. Естественно, любые проблемы, которые связаны с подушками двигателя, приводят к тому, что эффективность опор двигателя падает и возникает сильный дискомфорт. Также по ряду причин эксплуатация транспортного средства может быть затруднена.

    Читайте в этой статье

    Подушка двигателя

    : на что она влияет и как работает

    На разных отечественных и иномарках до 80-х опорой двигателя фактически служили плотные шины, которые прикручивались к двигателю и кузову.Это решение использовалось повсеместно на автомобилях, которые в то время в подавляющем большинстве были с задним приводом. При этом простые опоры хорошо справились со своими задачами.

    Однако в дальнейшем корпус стал легче, толщина стали уменьшилась, требования к пассивной безопасности и т. Д. В результате подушка превратилась в более сложный кусок металла и резины. В элитных моделях авто появились гидроопоры двигателя, которые способны обеспечить максимальный комфорт по сравнению с другими аналогами.

    Итак, двигатель современной легковой машины С приводом на передние колеса часто крепится на 4 или 5 опорах. Как правило, две подушки располагаются на КПП, остальные крепятся к силовому агрегату. Сам двигатель и коробка имеют жесткую связь.

    Что касается FROS, то здесь принято выделять правую подушку, а также переднюю и заднюю. Правая подушка безопасности закреплена на переднем правом лонжероне. Такая подставка располагается сверху. Передняя подушка двигателя часто крепится к передней балке, расположенной внизу.Задняя подушка тоже внизу, ее можно прикрепить как к днищу, так и к подрамнику. Кстати, на многих моделях задняя опора конструктивно отсутствует.

    Если говорить о конструкции, то резинометаллические опоры двигателя могут отличаться по форме и материалам изготовления, однако металлический цилиндр часто базируется на основании, которое прижимается сайлентблоком.

    Основная задача - надежная, но не жесткая фиксация ДВС, при этом подушка одновременно поглощает вибрацию и гасит возникающие колебания.В результате улучшается управляемость транспортного средства, сам двигатель менее подвержен вибрационной нагрузке, навесное оборудование в меньшей степени страдает от вибраций, колебания мало передаются на кузов автомобиля и т. Д.

    Порвалась подушка двигателя: признаки

    Как и любая другая деталь, опорная силовая установка также имеет ограниченный срок службы и со временем выходит из строя. В среднем подушки на современных автомобилях рассчитаны не менее чем на 100-120 тыс. Км, хотя на практике замена этих элементов может потребоваться как раньше, так и значительно позже этого срока.

    Обычно причиной проблем становится резиновая вставка, которая просто трескается и отрывается от нагрузки. Реже появляются трещины в металлической части опоры, нарушаются места установки крепежа и т. Д.

    Так или иначе, при неисправности мотора обычно указывают такие симптомы:

    1. Сам двигатель работает точно, но водитель ощущает явный прирост вибраций на кузове, на рулевом колесе, на ручке коробки передач и т. Д.;
    2. В момент начала движения с места, а также при торможении в бювете слышны моментальные снимки или приглушенные стуки;
    3. При движении по неровной дороге слышно переднюю часть автомобиля, такие удары во многих случаях ощущаются по рычагу КПП, переключение передач на «механике» в этот момент может быть затруднительным;
    Почему двигатель может вибрировать на холостом ходу. Причины неисправности, диагностика. Советы и рекомендации по снижению уровня вибрации мотора.
  • Подушки двигателя автомобиля: Назначение. Типы силовых агрегатов и конструктивные отличия. Признаки неисправности подушек ДВС и проверка.
  • Основное назначение опоры двигателя - компенсация вибрационных и колебательных движений, передаваемых рабочим механизмом кузова автомобиля. Без него невозможно комфортное путешествие, процесс будет напоминать полет на старой «кукурузе».

    Следует отметить, что подушка двигателя представляет собой специальную прокладку, отделяющую двигатель от элементов кузова.Таким изделием оснащались старые советские легковые автомобили из цельного отрезка резины, дополненные крепежными элементами с противоположных сторон. К тому же производители начали выпускать с передним приводом только в 1985 году.

    Сегодня опора двигателя чаще всего представляет собой резинометаллическую прокладку. Гидравлические изделия есть, но благодаря ощутимой стоимости они используются только для дорогих автомобилей.

    Признаки неисправности

    При пересечении препятствий в районе коробки передач наблюдается характерный стук, нарушающий шумоизоляцию в салоне, скорее всего, следует обратить внимание на замену подушки двигателя.Кроме того, сильная вибрация, передаваемая корпусу легкового автомобиля, свидетельствует о дефекте такой прокладки. Если рабочий двигатель начинает стучать по раме, значит, необходима срочная замена опоры двигателя.

    Следует обращать внимание на состояние подушек, когда машины и другие посторонние звуки впереди появляются при торможении и в начале движения машины. Тревогу следует вызывать, если в салоне возникает ширма при преодолении ям и выборах на дороге.Если движение по бездорожью сопровождается возвратами на рычаг переключения скоростей, опора подлежит немедленной замене.

    А также свидетельством признаков неисправности подушек безопасности двигателя является значительное повышение уровня вибрации при запуске или выключении механизма. Игнорировать такие симптомы категорически не рекомендуется. Последствия могут быть очень неприятными, в конечном итоге выражаясь в деформации подвески и кузова, преждевременном износе трансмиссии.

    Поэтому, если в автомобиле есть следы подушек безопасности двигателя, то прокладки подлежат замене.

    Самостоятельная диагностика подвески

    При невозможности или нежелании посетить автосервис, существует возможность определения неисправности персоналом. Самостоятельная проверка состояния подушки двигателя производится с помощью следующих приспособлений:

    1. гидравлический или пневматический домкрат. Это устройство способствует облегчению доступа к проверенным подушкам;
    2. специальная опора безопасности.В таких как чаще всего используется деревянный брус;
    3. или
    4. крепление или достаточно прочная палка, выполняющая роль рычага.
    • Автомобиль загнан в гараж или другое помещение. Твердая поверхность пола считается обязательным условием;
    • Домкрат установленный под переднее колесо поднимается автомобилем. У заднеприводных автомобилей подъемное устройство размещается под задним колесом; Под двигатель устанавливается опора
    • , чтобы обеспечить отсутствие нагрузки на опору двигателя.Убедившись в устойчивости положения автомобиля, домкрат опускают.

    Используя подкаст, устраиваем под автомобилем и проводим визуальный осмотр. Такой метод проверки позволяет легко проверить подушки двигателя на признаки неисправности, обнаруженные подушками двигателя во время работы.

    Даже неопытный автолюбитель сможет увидеть симптомы пучка опор, трещин и разрывов на изделии, а также самостоятельно определить, что прокладка вышла из строя в результате чрезмерного застывания резины.В таких случаях настоятельно рекомендуется срочно заменить подушку двигателя.

    Недостаточно обнаружить возможный люфт при соединении двигателя с передней балкой или визуальным осмотром. Здесь вам нужно будет использовать крепление. Подобный рычаг используется для отклонения в разные стороны. Отсутствие люфта свидетельствует о исправности опор, ремонт подушек не требуется.

    Устранить подобный симптом можно следующим образом:

    • снова поднять домкрат;
    • снимите предохранительную опору;
    • Проверить качество фиксации подушки двигателя и при необходимости подтянуть крепление гаечным ключом или трещоткой.

    Таким образом избавляемся от люфта.

    Самостоятельная замена опоры двигателя

    Чтобы содержать свой автомобиль в безупречном состоянии, необходимо регулярно проверять техническое состояние. Поскольку поломка одной детали способна справиться со всем дорогостоящим агрегатом, необходимо своевременно производить замену неисправного механизма.

    Предлагаем Вам подробную инструкцию Как поменять неподходящие подушки двигателя своими руками:

    1. Оставив аккумулятор при снятии клемм, автомобиль поднимается на достаточную высоту для обеспечения удобного доступа к мотору.После применения домкрата автомобиль надежно фиксируется деревянными брусками;
    2. с помощью того же подъемного устройства поднять мотор, освободив нужную деталь от груза;
    3. крепление подушки двигателя осуществляется при помощи определенного количества болтов, которые следует снимать, предварительно продвигая;
    4. После удаления неподходящей детали новая запчасть устанавливается на соответствующее место. Крепеж в виде болтов надежно фиксируется гидрофорезом двигателя. Стоит отметить, что рабочий мотор при затяжке крепежа позволит уберечь автомобиль от последующей чрезмерной вибрации;
    5. Завершение установки подушки опоры двигателя сопровождается возвратом на места всех демонтированных деталей.

    Отдельно отметим, что все предложенные манипуляции рекомендуется выполнять в паре с ассистентом. Потребуется посторонняя деталь для направления рычага двигателя при установке опоры в нужное место.

    Осмотр и замена верхней подушки - довольно простой процесс. Доступность манипуляций обеспечивается возможностью обойтись без ямы. Кроме того, поднимать машину не нужно.

    Заключение

    Регулярная проверка состояния подушек опор двигателя способствует предотвращению многих проблем в перспективе. Своевременная замена неподходящей опоры обеспечивает комфортное нахождение пассажиров в легковом автомобиле.

    Если внимательно следить за исправностью всех узлов и систем машины, рекомендуется периодически проверять подушки. Как показало предыдущее исследование, все необходимые манипуляции можно провести самостоятельно, без помощи специалистов автосервиса.

    Расскажем, как определить поломку подушки, как заменить подушку двигателя и что может вытащить поломку одной из деталей.


    Определите причину поломки подушки двигателя, она поддерживается, начинается с простого удара двигателем по раме или передачи сильной вибрации на кузов автомобиля. Часто поломка одной подушки перетягивает и поломка других подушек и деталей двигателя, поэтому ремонтом лучше не затягивать.

    Как определить поломку подушки двигателя

    Сразу понимаешь тяжело, лопнула подушка двигателя или вибрация передается с другой стороны, дороги.При запуске двигателя будет передаваться вибрация и некоторые автолюбители грешат, что двигатель не грелся, а потому не обращают внимания. Бывает, когда вибрация появляется даже на прогретом двигателе и исчезает даже при движении. Когда подушка двигателя вышла из строя полностью, будет слышен характерный металл из металла металл.

    Можно добраться до ближайшей сотки или домой с такими симптомами, нельзя водить машину желательно не более 60 км / ч.Часто изнашивается задняя или левая опора. Осмотреть его можно на смотровой яме, где можно увидеть как боковые подушки, так и задние. Если вы обнаружили поломку одной подушки, будьте готовы, которую однозначно другую придется менять. После осмотра подготовьте запчасти к замене, так как во время замены вы можете путешествовать на автомобиле.


    Замену лучше проводить в теплую погоду или в теплом помещении, так как работа будет с резиновыми деталями, а, как известно, на морозе резина твердеет, и замена будет жесткой. .Для замены лучше всего подъехать к смотровой яме. Затем выключите аккумулятор, чтобы избежать замыкания. Часто осмотр начинается с передней левой стороны, так как его легче поменять, а чаще всего это не удается. Если крепеж разрезан, то можно отремонтировать, так как подушки двигателя на простую иномарку около 2000 рублей, на внедорожник около 4000 рублей. Если пробой в резиновой части опоры, то однозначно нужно ставить новые. На сотню такая замена стоит около 300? 500 рублей за переднюю и боковую подушку и около 700 рублей за заднюю подушку.

    Процесс поддержки двигателя


    Снимите защиту с двигателя, чтобы облегчить доступ к нужным деталям. В первую очередь нужно закрепить двигатель с помощью домкрата, на смотровой яме это сделать несложно, заменив перекладину на большую доску, чтобы мы могли выдержать часть веса двигателя. Это сделано для того, чтобы при откручивании опоры двигатель увидит и ни за что не дотянется.

    Подняв максимально двигатель, чтобы было удобно откручивать болты крепления, снимаем крепление.В обратном порядке кладем новую подушку, хорошо зажимаем болты и переходим к задней подушке, именно с нее и начинаются танцы с бубном, так как по ходу движения машины возникает наибольшая нагрузка. В результате сам крепеж не только легкий, что не похоже на предыдущие, но и деформируются болты крепления.

    Поднять двигатель больше не получится, лучше сверху привязать к балке или надеть стаканы на перекладину и подвесить двигатель, предварительно приподняв его домкратом.На некоторых автомобилях придется снимать штаны или другие детали, которые могут помешать замене. Если болт крепления сильно деформирован, его придется срезать болгаркой иначе не откручивайте, некоторые шайбы выравнивают болт, но это ненадолго, через время приходится выравнивать или менять на новый.

    Для того, чтобы убрать подушку с места посадки, смажьте маслом или WD-40, часто из-за попадания грязи на подушку может толкнуть каркас. Важным моментом является установка, на задней подушке есть направляющая, либо другую стрелку, указывающую направление движения автомобиля, не стоит путать, потому что через время она может снова пробиться.Собрав все в обратном порядке, переходим к правой подушке двигателя. У этой опоры тоже есть проблема с деформированными болтами, но основной проблемой становится генератор или компрессор кондиционера. Как мы помним, снимать компрессор кондиционера не рекомендуется, так как в результате разгерметизации выйдет весь фреон, а доливка будет стоить даже дороже подушек вместе с заменой.

    Если вы решили поменять подушки двигателя на сотку, не поленитесь проверить работоспособность кондиционера или есть ли в нем давление после ремонта, так как недобросовестные рабочие для экономии времени могут просто снять компрессор, и от тебя можно спрятаться.


    В большинстве иномарок правая подушка находится ближе к правой передней части, поэтому часто снимают правую переднюю фару и решетку радиатора, тем самым упрощая процедуру замены.

    Освободив место для снятия подушки, столкнувшись с проблемой деформации болтов, болгарка никак не режет, так как можно повредить соседние детали или просто не добраться до болтов. Я бы посоветовал взять металлический костяк и потихоньку отрезать болт, процедура хоть и долгая, но все же, не повредить соседние детали.Сняв подушку, ставим новую в обратном порядке, осторожно с радиатором, так как около его ячеек можно порезать руки.

    Безопасность в работе

    Основным критерием безопасности при эксплуатации должен быть исправный двигатель, желательно позвонить партнеру, чтобы вдохновить или помочь с заменой.

    Видео с подсказками, как определить повреждение подушки безопасности двигателя:

    Видео, как заменить подушку двигателя на автомобиле Гольф 2:

    Для замены подушек безопасности двигателя обычно требуется только умение держать инструменты в руках и их большинство.Часто для работ, которые сами по себе не составляют большого труда (например, замена заглушек блока цилиндров на переднеприводных вазах), требуется снять двигатель.
    При этом процедура замены, например, нижней опоры двигателя, проводится «попутно», если этого требует ее состояние.
    Современные автомобили часто имеют «плотную» компоновку, поэтому иногда подушки двигателя приобретают дополнительные функции - например, опорный кузов может служить кронштейном для любого узла, например, на Peugeot 307.Мы не будем рассматривать такие «экзотические» варианты, наиболее четко принципы крепления мотора проще рассмотреть на отечественных автомобилях - недаром для многих опытных мастеров наши автомобили играли роль «буквы».

    Износ подушки двигателя

    Изношенная подушка двигателя

    В зависимости от того, какая из подушек под двигателем сломалась, признаками ее неисправности могут быть:

    Неисправные подушки определяются по разрывам резиновых амортизаторов или поломке алюминиевых кронштейнов.

    1. Вибрация двигателя на холостом ходу.
    2. Посторонние стуки при движении, ощущаемые в отсеке для ходовой части или под коробкой передач.
    3. Штанга с динамическим разгоном авто.
    4. Стуки в моторном отсеке при запуске или остановке двигателя.
    5. Затрудненное переключение передач.

    На автомобилях с гидравлическими опорами дополнительно может ухудшиться динамика разгона.
    Визуально неисправные подушки можно определить по расслоению и разрывам резиновых амортизаторов или поломке алюминиевых кронштейнов.Опытный специалист может также определить конкретную подушку по тому, насколько деформирован демпфер.

    Разновидности подушек

    Разновидности автомобильных подушек двигателя


    Роль демпфера двигателя обычно играет резина, поглощающая удары и вибрацию.

    Несмотря на разнообразие вариантов исполнения, общее назначение подушек - выполнять роль подвески двигателя, т.е. убирать колебания и колебания в силовом агрегате.Роль демпфера двигателя обычно играет резина (иногда реагирующая со свойствами гидравлического масла), поглощающая удары и вибрацию, не допуская смещения силового агрегата.
    В качестве примера можно взять опору двигателя на Ниве. Это резиновый цилиндр с приваренными пластинами с резьбовыми пятками. Левая и правая опоры двигателя абсолютно одинаковые, третья, опорная, имеет несколько иной внешний вид и установлена ​​на поперечине, закрепленной на днище автомобиля.
    Размеры опор и точки их крепления рассчитаны таким образом, чтобы не допустить смещения силового агрегата, а вес двигателя сжимает подушку, и она распределяется таким образом, что резина ломается из-за ее сдвиговой деформации. практически исключен.
    Точно так же на «Волге» устанавливался двигатель, расположенный также на продольной оси автомобиля.
    А вот с поперечным расположением двигателя несколько сложнее, в силу конструкции силового агрегата в целом.Поэтому опоры чаще всего приобретают тип рычагов подвески, как демпфер двигателя, имеющий сайлентблоки, как на дополнительных опорах ВАЗ 2112:
    Такая конструкция опоры также иногда вызвана необходимостью опоры наиболее удаленных от нее точек. корпус двигателей, который после модернизации приобрел большую массу. Применение дополнительных опор позволяет устанавливать более тяжелые моторы без существенных изменений конструкции автомобиля.
    Наиболее характерно для относительно небольших силовых агрегатов то, как они "висят", как у 2108 -09.
    Двигатель в сборе с КПП имеет три точки крепления:

    • опора двигателя левая;
    • задняя (нижняя) опора двигателя.

    Как работают подушки двигателя

    Опора подушек двигателя автомобиля


    Подушки работают аналогично Silent Silent Silent, то есть скручивают резину.

    Подушки

    работают аналогично Silent Silent Silent, то есть скручивают резину. Поэтому на автомобилях, эксплуатируемых в основном на плохих дорогах, т.к. такие опоры оказываются ненадежными - резина отделяется.
    Более компактные автомобили с относительно тяжелой (по отношению к общей массе машины) подвеской несколько иначе - резиновый демпфер работает на сжатие-растяжение, что увеличивает срок его службы. К тому же такие опоры более жестко фиксируют двигатель.
    Но слабое место Такие опоры могут стать слишком длинными кронштейном крепления подушки двигателя, если он составляет с ней единое целое и изготовлен из алюминиевого сплава. При «посеве» резины неосторожная езда по неровной дороге может привести к его поломке.
    Гидравлические (или гидромеханические) подушки двигателя отличаются от обычных тем, что имеют переменную жесткость. Это достигается за счет отбора проб двигателя. При достижении определенного количества оборотов клапан, разделяющий опорные камеры, закрывается. В результате жидкость (антифриз) до того, как камера вытекла из камеры, начинает играть роль упругого элемента. Внешне такие опоры отличаются в основном наличием штуцера для подключения вакуумного шланга и кабеля.
    Такие подушки предназначены для очистки двигателя от вибраций, основная часть которых «лежит» на других опорах.

    Замена подушки двигателя автомобиля


    Для замены подушки достаточно сжать двигатель так, чтобы опора была разгружена.

    Цена работ по замене подушки двигателя обычно небольшая - от 500 руб за штуку. Исключение могут составлять «ходовые» автомобили.
    Например, это количество может быть значительно больше, если в отверстиях корпуса КПП, предназначенных для болтов или крепления опоры опоры, уже порваны сами резьбы или шпильки.Часто требуется демонтаж агрегата - иначе зал не просверлите и не нарежьте резьбу - пространство не позволяет провести эти работы на месте.
    Часто бывает, что при отворачивании болтов крепления опор к лонжерону или подрамнику закладные приварные гайки внутри последнего ломаются. Бывает, например, при замене левой подушки на Дэу - Нексия. Вам предстоит сделать в окошке «Окно» и приварить гайку.
    Особенно много хлопот может доставить и замена заднего моста двигателя на старом ВАЗ 2108 - 2110 - иногда приходится поприветствовать «расплату», заменяя часть прогнившего днища.
    Но это скорее исключения. В целом процедура замены довольно проста. Достаточно разместить двигатель так, чтобы опора была разгружена. Для этого можно использовать установленную на доске, поставленную на смотровую яму. Ненагруженная подушка обычно довольно легко снимается и заменяется новой. Иногда может потребоваться дополнительная разборка для обеспечения доступа к опоре.

    Запчасти для

    Arctic Cat | Деннис Кирк

    Будь то работа или отдых, ваш Arctic Cat сможет безупречно бегать.Ничто не может сравниться с тем рывком, который вы получаете, когда нажимаете на педаль газа. Вот почему в Dennis Kirk мы предлагаем самый большой выбор запчастей и аксессуаров Arctic Cat по самым низким гарантированным ценам. Будь то квадроцикл, бок о бок или снегоход, вы найдете именно то, что вам нужно, чтобы ваша машина работала именно так, как вы этого хотите. У нас более 45 лет опыта поиска лучших запчастей, поэтому мы можем предложить все, что вам нужно. Наша миссия - сделать вашу поездку максимально качественной.

    Для всех ваших потребностей в техническом обслуживании и ремонте у нас есть огромный выбор запасных частей для прямой замены Arctic Cat, которые так же хороши, если не лучше, чем O.E.M. Имея под рукой компоненты двигателя, впускные и топливные компоненты, заменяемые фильтры и все электрическое оборудование, ваш Arctic Cat может работать как новый. Заменив потрепанный пластик и крылья запасными частями кузова, ваша машина тоже будет выглядеть как новая. Используйте переключатель езды вверху страницы, чтобы найти точные детали для вашей машины.

    Если вам нужна большая мощность и лучший отклик дроссельной заслонки, вы найдете нужные вам детали Arctic Cat. Модернизация выхлопной системы, впуска, компонентов двигателя и т. Д. Упрощается с помощью всего, что у нас есть. Добавление аксессуаров и багажа может сделать вашу машину более индивидуальной в зависимости от того, как вы едете и для чего вы ее используете. Вы можете настроить Arctic Cat так, как хотите, с помощью деталей от DK.

    Мы храним все запчасти Arctic Cat на складе и готовы к отправке в тот же день, когда вы заказываете.Таким образом, вы сможете быстро получить то, что вам нужно, и сразу же вернуться к катанию. Мы хотим, чтобы ваша следующая поездка была вашей лучшей поездкой, и поэтому мы предлагаем так много отличных товаров от всех ведущих брендов. Вы также можете уверенно делать покупки с нашей политикой возврата в течение 90 дней без хлопот. Если вы ищете запчасти для снегохода или квадроцикла, у Денниса Кирка вы найдете то, что вам нужно.

    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Changelog - Airflow Documentation

  • [AIRFLOW-2870] Использование абстрактного TaskInstance для миграции

  • [AIRFLOW-2859] Реализовать собственный UtcDateTime (# 3708)

  • [AIRFLOW-2140] Не требуется кубернетов для обработчика SparkSubmit

  • [AIRFLOW-2869] Удалить умную цитату из конфигурации по умолчанию

  • [AIRFLOW-2857] Исправление Прочтите документы env

  • [AIRFLOW-2817] Принудительный явный выбор в зависимости от GPL

  • [AIRFLOW-2716] Замените async и ожидайте py3.7 ключевых слов

  • [AIRFLOW-2810] Исправить опечатку в метке времени модели Xcom

  • [AIRFLOW-2710] Уточните значение ключа Fernet в документации

  • [AIRFLOW-2606] Исправить схему БД и модель SQLAlchemy

  • [AIRFLOW-2646] Исправьте setup.py, чтобы не устанавливать snakebite на Python3

  • [AIRFLOW-2604] Добавить индекс в task_fail

  • [AIRFLOW-2650] Отметить SchedulerJob как успешное при нажатии Ctrl-c

  • [AIRFLOW-2678] Исправить модульный тест схемы базы данных для удаления проверки моделей fab

  • [AIRFLOW-2624] Исправить вход на веб-сервер как анонимный

  • [AIRFLOW-2654] Исправить неправильный URL-адрес при обновлении в графическом представлении FAB UI

  • [AIRFLOW-2668] Обработка отсутствующей дополнительной криптографической зависимости

  • [AIRFLOW-2681] Включить в пользовательский интерфейс последний запуск DAG-файлов, запускаемых извне.

  • [AIRFLOW-1840] Поддержка обратной совместимости на старой конфигурации сельдерея

  • [AIRFLOW-2612] [AIRFLOW-2534] Очистить тесты, связанные с ульем

  • [AIRFLOW-2608] Реализует / стандартизирует пользовательские исключения для экспериментальных API

  • [AIRFLOW-2607] Исправить ошибку TestLocalClient

  • [AIRFLOW-2638] dbapi_hook: support ЗАМЕНИТЬ НА

  • [AIRFLOW-2542] [AIRFLOW-1790] Переименовать очередь AWS Batch Operator в job_queue

  • [AIRFLOW-2567] Извлечь результат из модуля kubernetes как Xcom

  • [AIRFLOW-XXX] Добавление группы REA в файл readme

  • [AIRFLOW-2601] Разрешить пользователю указывать конфигурацию k8s

  • [AIRFLOW-2559] Хук Azure Fileshare

  • [AIRFLOW-1786] Обеспечить правильное поведение для датчиков с мягким отказом

  • [AIRFLOW-2355] Параметры тега триггера воздушного потока во вложенном теге

  • [AIRFLOW-2613] Исправить поиск воздушного потока.ошибка zip

  • [AIRFLOW-2627] Добавить датчик для Cassandra

  • [AIRFLOW-2634] [AIRFLOW-2534] Удалить зависимость для impyla

  • [AIRFLOW-2611] Исправить неправильный путь монтирования тома dag для исполнителя kubernetes

  • [AIRFLOW-2562] Добавить операторов Google Kubernetes Engine

  • [AIRFLOW-2630] Исправить имя класса в test_sql_sensor.py

  • [AIRFLOW-2534] Исправить ошибку в HiveServer2Hook

  • [AIRFLOW-2586] Прекратить получение значения AIRFLOW_HOME из файла конфигурации в операторе bash

  • [AIRFLOW-2605] Исправить автоматическую фиксацию для MySqlHook

  • [AIRFLOW-2539] [AIRFLOW-2359] Переместить оставшуюся конфигурацию журнала в файл конфигурации

  • [AIRFLOW-1656] Запрос dags древовидного представления изменен

  • [AIRFLOW-2617] добавить конфигурацию imagePullPolicy для исполнителя kubernetes

  • [AIRFLOW-2429] Исправить ошибку flake8 папок security / task / sensor / ti_deps

  • [AIRFLOW-2550] Реализует конечную точку API для вывода списка запусков DAG

  • [AIRFLOW-2512] [AIRFLOW-2522] Использовать google-auth вместо oauth3client

  • [AIRFLOW-2429] Исправить ошибку в папке с операторами flake8

  • [AIRFLOW-2585] Исправить несколько ошибок в CassandraHook и CassandraToGCSOperator

  • [AIRFLOW-2597] Восстановить исходный dbapi.run () поведение

  • [AIRFLOW-2590] Исправить фиксацию в DbApiHook.run () для БД без автоматической фиксации

  • [AIRFLOW-1115] исправить github oauth api URL

  • [AIRFLOW-2587] Добавить сопоставление типа TIMESTAMP в MySqlToHiveTransfer

  • [AIRFLOW-2591] [AIRFLOW-2581] Установить значение по умолчанию для автоматической фиксации на False в DbApiHook.run ()

  • [AIRFLOW-59] Реализовать bulk_dump и bulk_load для обработчика Postgres

  • [AIRFLOW-2533] Исправить путь к DAG для рабочих исполнителей kubernetes

  • [AIRFLOW-2581] RFLOW-2581] Исправить автоматическую фиксацию DbApiHook

  • [AIRFLOW-2578] Добавить возможность использования прокси в JiraHook

  • [AIRFLOW-2575] Сделать оператор gcs to gcs работать с большими файлами

  • [AIRFLOW-437] Отправить контекст TI в kill zombies

  • [AIRFLOW-2566] Изменить обратную засыпку для повторного выполнения невыполненных задач

  • [AIRFLOW-1021] Исправить двойной вход для новых пользователей с LDAP

  • [AIRFLOW-XXX] Исправление опечатки

  • [AIRFLOW-2561] Исправить опечатку в EmailOperator

  • [AIRFLOW-2573] Преобразование поля BigQuery TIMESTAMP в плавающее значение

  • [AIRFLOW-2560] Добавление поддержки internalIpOnly в DataprocClusterCreateOperator

  • [AIRFLOW-2565] шаблон cluster_label

  • [AIRFLOW-83] добавить крючок монго и оператор

  • [AIRFLOW-2558] Очистить задачу / тег очищает все исполнения

  • [AIRFLOW-XXX] Исправить опечатки в документации

  • [AIRFLOW-2513] Измените bql на sql для BigQuery Hooks & Ops

  • [AIRFLOW-2557] Исправить разбиение на страницы для s3

  • [AIRFLOW-2545] Устранение предупреждения об устаревании

  • [AIRFLOW-2500] Исправить MySqlToHiveTransfer для правильной передачи беззнакового типа

  • [AIRFLOW-2462] Изменить пароль пользователя для исправления синтаксиса

  • [AIRFLOW-2525] Исправить ошибку, появившуюся при фиксации dabf1b9

  • [AIRFLOW-2553] Добавить веб-сервер.pid в .gitignore

  • [AIRFLOW-1863] [AIRFLOW-2529] Добавить виджеты выбора прогона dag в просмотр диаграммы

  • [AIRFLOW-2504] Правильно регистрировать имя пользователя и добавлять дополнительные в столбцы поиска

  • [AIRFLOW-2551] Кодировать двоичные данные со стандартом base64, а не с url-адресом base64

  • [AIRFLOW-2537] Добавить параметр reset-dagrun в команду обратной засыпки

  • [AIRFLOW-2526] dag_run.conf может отменять параметры

  • [AIRFLOW-2544] [AIRFLOW-1967] Защита от следующего крупного выпуска сельдерея, Flower

  • [AIRFLOW-XXX] Добавьте Yieldr тем, кто использует воздушный поток

  • [AIRFLOW-2547] Опишите, как запускать тесты с помощью Docker

  • [AIRFLOW-2538] Обновите документ с часто задаваемыми вопросами о том, как уменьшить задержку планировщика воздушного потока

  • [AIRFLOW-2529] Повышение производительности и удобства использования графического представления

  • [AIRFLOW-2517] поддержка обратной засыпки, передача ключевых значений через интерфейс командной строки

  • [AIRFLOW-2532] Поддержка logs_volume_subpath для KubernetesExecutor

  • [AIRFLOW-2466] рассмотреть task_id в _change_state_for_tis_without_dagrun

  • [AIRFLOW-2519] Исправить CeleryExecutor с помощью SQLAlchemy

  • [AIRFLOW-2402] Исправить журнал задач RBAC

  • [AIRFLOW-XXX] Добавить M4U в список пользователей

  • [AIRFLOW-2536] документы о том, как бороться с ошибкой initdb Airflow

  • [AIRFLOW-2530] KubernetesOperator поддерживает несколько кластеров

  • [AIRFLOW-1499] Удалить повторяющийся и ненужный код

  • [AIRFLOW-2521] backfill - сделать имя переменной и сообщения журнала более точными

  • [AIRFLOW-2429] Исправить перехватчик, ошибка папки макросов flake8

  • [Airflow-XXX] добавить Prime в список компаний

  • [AIRFLOW-2525] Исправить PostgresHook.copy_expert для работы с «КОПИРОВАТЬ ИЗ»

  • [AIRFLOW-2515] Добавить зависимость от thrift_sasl к дополнительному улью

  • [AIRFLOW-2523] Добавьте инструкции по управлению соединениями GCP

  • [AIRFLOW-2510] Ввести новые макросы: prev_ds и next_ds

  • [AIRFLOW-1730] Неупакованное значение XCom, запрошенное из базы данных

  • [AIRFLOW-2518] Исправить неработающие ссылки ToC в integration.rst

  • [AIRFLOW-1472] Исправлено пропущенное срабатывание SLA при пропущенных задачах.

  • [AIRFLOW-2520] CLI - сделать обратную засыпку менее подробной

  • [AIRFLOW-2107] добавить time_partitioning в run_query на BigQueryBaseCursor

  • [AIRFLOW-1057] [AIRFLOW-1380] [AIRFLOW-2362] [2362] AIRFLOW Обновить DockerOperator до нового API

  • [AIRFLOW-2415] Сделать номера рендеринга шаблонов Airflow DAG

  • [AIRFLOW-2473] Исправить неправильное условие пропуска для TransferTests

  • [AIRFLOW-2472] Реализуйте MySqlHook.bulk_dump

  • [AIRFLOW-2419] Использовать вид по умолчанию для оператора subdag

  • [AIRFLOW-2498] Исправить неожиданный аргумент в датчике SFTP

  • [AIRFLOW-2509] Отдельные документы по конфигурации в практических руководствах

  • [AIRFLOW-2429] Добавить BaseExecutor назад

  • [AIRFLOW-2429] Исправить dag, example_dags, ошибку исполнителя flake8

  • [AIRFLOW-2502] Заменить одинарные тройные кавычки на двойные для строк документации

  • [AIRFLOW-2503] Исправьте неработающие ссылки в СОДЕРЖАНИИ.мкр

  • [AIRFLOW-2501] См. Инструкции по разработке в docs contrib guide

  • [AIRFLOW-2429] Исправить ошибки flake8 в папке contrib

  • [AIRFLOW-2471] Исправьте HiveCliHook.load_df для использования неиспользуемых параметров

  • [AIRFLOW-2495] Обновление сельдерея до версии 4.1.1

  • [AIRFLOW-2429] Исправить api, bin, config_templates папок flake8 ошибка

  • [AIRFLOW-2493] Отметить template_fields всех операторов в документе API как «шаблонные»

  • [AIRFLOW-2489] Обновите FlaskAppBuilder до 1.11,1

  • [AIRFLOW-2448] Расширьте HiveCliHook.load_df для работы с datetime

  • [AIRFLOW-2487] Перехватчик перехвата друидов

  • [AIRFLOW-2397] Поддержка политик соответствия для исполнителя / оператора Kubernetes

  • [AIRFLOW-2482] Добавить тест для метода перезаписи в GCS Hook

  • [AIRFLOW-2481] Исправить нестабильный тест Kubernetes

  • [AIRFLOW-2479] Улучшение раздела часто задаваемых вопросов о документации

  • [AIRFLOW-2485] Исправить неправильное ведение журнала для датчика Qubole

  • [AIRFLOW-2486] Удалите ненужную косую черту после порта

  • [AIRFLOW-2429] Обеспечить соответствие Airflow flake8

  • [AIRFLOW-2491] Устранение конфликта версий колбы

  • [AIRFLOW-2484] Удалить дубликат ключа в MySQL в GCS Op

  • [AIRFLOW-2458] Добавить оператора cassandra-to-gcs

  • [AIRFLOW-2477] Улучшение единиц времени для длительности задач и диаграмм времени посадки для RBAC UI

  • [AIRFLOW-2474] Импортировать только snakebite при использовании py2

  • [AIRFLOW-48] Разобрать строку запроса uri соединения

  • [AIRFLOW-2467] [AIRFLOW-2] Обновить сообщение прямого предупреждения об импорте, чтобы использовать имя модуля

  • [AIRFLOW-XXX] Фикс заказ компаний

  • [AIRFLOW-2452] Документ field_dict должен быть OrderedDict

  • [AIRFLOW-2420] Azure Data Lake Hook

  • [AIRFLOW-2213] Добавить оператора проверки Qubole

  • [AIRFLOW-2465] Исправьте неправильные имена модулей в документе

  • [AIRFLOW-1929] Изменение TriggerDagRunOperator, чтобы он принимал дату выполнения

  • [AIRFLOW-2460] Теперь пользователи могут использовать монтирования томов и тома

  • [AIRFLOW-2110] [AIRFLOW-2122] Enhance Http Hook

  • [AIRFLOW-XXX] Обновлен список участников

  • [AIRFLOW-2435] Добавьте launch_type в ECSOperator, чтобы разрешить FARGATE

  • [AIRFLOW-2451] Удалить лишнюю косую черту (‘/’) при использовании подстановочного знака в операторе gcs_to_gcs

  • [AIRFLOW-2461] Добавить поддержку масштабирования кластера для оператора dataproc

  • [AIRFLOW-2376] Исправить ошибку без раздела куста

  • [AIRFLOW-2425] Добавить поддержку линии

  • [AIRFLOW-2430] Расширение пакетной обработки запросов до дополнительных медленных запросов

  • [AIRFLOW-2453] Добавить нулевое значение по умолчанию для kubernetes / git_subpath

  • [AIRFLOW-2396] Добавить поддержку ресурсов в операторе kubernetes

  • [AIRFLOW-2169] Кодируйте двоичные данные с помощью base64 перед импортом в BigQuery

  • [AIRFLOW-XXX] Добавить дом в список пользователей

  • [AIRFLOW-2457] Обновление требований к версии FAB

  • [AIRFLOW-2454] [Airflow 2454] Поддержка imagePullPolicy для k8s

  • [AIRFLOW-2450] обновляет поддерживаемые версии k8s до 1.9 и 1.10

  • [AIRFLOW-2333] Добавить перехватчик сегмента и TrackEventOperator

  • [AIRFLOW-2442] [AIRFLOW-2] Команда запуска воздушного потока оставляет соединения с базой данных открытыми

  • [AIRFLOW-2016] назначить template_fields для подклассов шаблона рабочего процесса Dataproc, а не для базового класса

  • [AIRFLOW-2446] Добавить S3ToRedshiftTransfer в документ «Интеграция»

  • [AIRFLOW-2449] Исправьте operator.py для запуска всех тестовых примеров

  • [AIRFLOW-2424] Добавить конечную точку состояния dagrun и увеличить тестовое покрытие k8s

  • [AIRFLOW-2441] Исправить ошибки в HiveCliHook.load_df

  • [AIRFLOW-2358] [AIRFLOW-201804] Сделайте пример Kubernetes необязательным

  • [AIRFLOW-2436] Удалить cli_logger в initdb

  • [AIRFLOW-2444] Удалить неиспользуемую опцию (include_adhoc) в команде cli backfill

  • [AIRFLOW-2447] Исправить TestHiveMetastoreHook для запуска всех случаев

  • [AIRFLOW-2445] Разрешить создание шаблонов в операторе Kubernetes

  • [AIRFLOW-2086] [AIRFLOW-2393] Настроить номер dagrun по умолчанию в виде дерева

  • [AIRFLOW-2437] Добавить PubNub в список текущих пользователей Airflow

  • [AIRFLOW-XXX] Добавить Quantopian в список пользователей Airflow

  • [AIRFLOW-1978] Добавить оператор Windows WinRM и перехватить

  • [AIRFLOW-2427] Добавить тесты к названному датчику улья

  • [AIRFLOW-2412] Исправить HiveCliHook.load_file для адреса HIVE-10541

  • [AIRFLOW-2431] Добавить параметр цвета панели навигации для пользовательского интерфейса RBAC

  • [AIRFLOW-2407] Разрешить неопределенные имена Python

  • [AIRFLOW-1952] Добавить параметр цвета панели навигации

  • [AIRFLOW-2222] Внедрить GoogleCloudStorageHook.rewrite

  • [AIRFLOW-2426] Добавить тесты Google Cloud Storage Hook

  • [AIRFLOW-2418] Bump Flask-WTF

  • [AIRFLOW-2417] Подождите, пока модуль не запущен, чтобы завершить задачу

  • [AIRFLOW-1914] Добавить поддержку других кодировок в утилиты электронной почты

  • [AIRFLOW-XXX] Обновите README.мкр с Craig @ Work

  • [AIRFLOW-1899] Исправить тесты Kubernetes

  • [AIRFLOW-1812] Пример регистрации обновлений

  • [AIRFLOW-2313] Добавить параметры TTL для Dataproc

  • [AIRFLOW-2411] добавить dataproc_jars в templated_fields

  • [AIRFLOW-XXX] Добавить Reddit для пользователей Airflow

  • [AIRFLOW-XXX] Исправить неправильный заголовок таблицы в scheduler.rst

  • [AIRFLOW-2409] Укажите пароль как параметр

  • [AIRFLOW-2410] [AIRFLOW-75] Установите часовой пояс в веб-интерфейсе RBAC

  • [AIRFLOW-2394] Команды и аргументы по умолчанию в операторе Kubernetes

  • [AIRFLOW-2406] Добавить лицензионный щит Apache2 в файл Readme

  • [AIRFLOW-2404] Добавить дополнительную документацию для задачи без очереди

  • [AIRFLOW-2400] Добавить возможность установки переменных среды для K8s

  • [AIRFLOW-XXX] Добавить Twine Labs в качестве пользователя Airflow

  • [AIRFLOW-1853] Показать только желаемое количество запусков в виде дерева

  • [AIRFLOW-2401] Документируйте использование переменных в шаблоне Jinja

  • [AIRFLOW-2403] Исправить заголовки лицензий

  • [AIRFLOW-1313] Исправить заголовок лицензии

  • [AIRFLOW-2398] Добавить BounceX в список текущих пользователей Airflow

  • [AIRFLOW-2363] Исправить ошибку типа возвращаемого значения в TaskHandler

  • [AIRFLOW-2389] Создание хука api для pinot db

  • [AIRFLOW-2390] Разрешить FlaskWTFDeprecationWarning

  • [AIRFLOW-1933] Исправить опечатки

  • [AIRFLOW-1960] Добавить поддержку секретов в операторе kubernetes

  • [AIRFLOW-1313] Добавить оператор vertica_to_mysql

  • [AIRFLOW-1575] Добавить крючок AWS Kinesis Firehose для вставки записей партии

  • [AIRFLOW-2266] [AIRFLOW-2343] Удаление зависимости google-cloud-dataflow

  • [AIRFLOW-2370] Реализуйте –use_random_password в create_user

  • [AIRFLOW-2348] Удалять префикс пути из целевого_объекта, если исходный_объект содержит подстановочный знак []

  • [AIRFLOW-2391] Исправление для Flask 0.12,2

  • [AIRFLOW-2381] Исправить нестабильный тест ApiPasswordTests

  • [AIRFLOW-2378] Добавить Groupon в список текущих пользователей

  • [AIRFLOW-2382] Исправить неправильное описание разделителя

  • [AIRFLOW-2380] Добавьте поддержку переменных среды в оператор отправки Spark.

  • [AIRFLOW-2377] Улучшение поддержки отправителя Sendgrid

  • [AIRFLOW-2331] Поддержка тайм-аута действия инициализации в кластере dataproc create

  • [AIRFLOW-1835] Обновить документы: файл переменной - json

  • [AIRFLOW-1781] Сделать поиск без учета регистра в группе LDAP

  • [AIRFLOW-2042] Исправить меню браузера, появляющееся над меню автозаполнения

  • [AIRFLOW-XXX] Удалить файлы рулевой рубки с трэвиса, не принадлежащего трэвису

  • [AIRFLOW-2336] Использовать hmsclient в hive_hook

  • [AIRFLOW-2041] Правильный синтаксис в примерах Python

  • [AIRFLOW-74] SubdagOperators могут использовать все рабочие процессы celeryd

  • [AIRFLOW-2369] Исправить тесты gcs

  • [AIRFLOW-2365] Исправить автоматическую проверку атрибута

  • [AIRFLOW-2068] MesosExecutor позволяет использовать дополнительный образ Docker

  • [AIRFLOW-1652] Отправить метаданные DatabricksRunSubmitOperator в XCOM

  • [AIRFLOW-2234] Включить insert_rows для PrestoHook

  • [AIRFLOW-2208] [Airflow-22208] Ссылка на тот же график DagRun из представления TaskInstance

  • [AIRFLOW-1153] Разрешить HiveOperators принимать hiveconfs

  • [AIRFLOW-775] Исправить настройки автоматической фиксации с помощью обработчика Jdbc

  • [AIRFLOW-2364] Предупреждать при установке автоматической фиксации для соединения, которое его не поддерживает

  • [AIRFLOW-2357] Добавить постоянный том для журналов

  • [AIRFLOW-766] Пропустить соед.commit () при автоматической фиксации

  • [AIRFLOW-2351] Проверить действительные значения default_args start_date

  • [AIRFLOW-1433] Установить rbac по умолчанию для initdb

  • [AIRFLOW-2270] Обработка удаленных задач в засыпке

  • [AIRFLOW-2344] Исправить соединения -l для работы с конвейером / перенаправлением

  • [AIRFLOW-2300] Добавить функцию S3 Select в S3ToHiveTransfer

  • [AIRFLOW-1314] Очистить конфигурацию

  • [AIRFLOW-1314] Отредактируйте некоторые документы / конфигурацию Kubernetes

  • [AIRFLOW-1314] Улучшение обработки ошибок

  • [AIRFLOW-1999] Добавить поддержку учетной записи службы GCP для каждой задачи

  • [AIRFLOW-1314] Перебазинг против мастера

  • [AIRFLOW-1314] Небольшая очистка для устранения комментариев по связям с общественностью (# 24)

  • [AIRFLOW-1314] Добавить файл execor_config и тесты

  • [AIRFLOW-1314] Улучшение поддержки k8s

  • [AIRFLOW-1314] Используйте VolumeClaim для транспортировки DAG

  • [AIRFLOW-1314] Создать среду тестирования интеграции

  • [AIRFLOW-1314] Git Mode для получения DAG для Kubernetes Executor

  • [AIRFLOW-1314] Добавить поддержку монтирования томов и секретов в Kubernetes Executor

  • [AIRFLOW = 1314] Базовый режим Kubernetes

  • [AIRFLOW-2326] [AIRFLOW-2222] удалить contrib.gcs_copy_operator

  • [AIRFLOW-2328] Исправить пустой объект GCS в S3ToGoogleCloudStorageOperator

  • [AIRFLOW-2350] Исправить грамматику в UPDATING.md

  • [AIRFLOW-2302] Документация по исправлению

  • [AIRFLOW-2345] pip не используется в этом setup.py

  • [AIRFLOW-2347] Добавить Banco de Formaturas в Readme

  • [AIRFLOW-2346] Добавьте Investorise в качестве официального пользователя Airflow

  • [AIRFLOW-2330] Не добавлять префикс пункта назначения, если он не задан

  • [AIRFLOW-2240] [DASK] Добавлена ​​поддержка TLS / SSL для планировщика, распределенного по dask.

  • [AIRFLOW-2309] Расчет продолжительности исправления для TaskFail

  • [AIRFLOW-2335] исправление проблемы при загрузке jdk8 для ci

  • [AIRFLOW-2184] Добавить druid_checker_operator

  • [AIRFLOW-2299] Добавить функцию S3 Select в S3FileTransformOperator

  • [AIRFLOW-2254] Поместить заголовок в первую строку при выгрузке

  • [AIRFLOW-610] Учитывать параметр _cmd в конфигурации до значений по умолчанию

  • [AIRFLOW-2287] Исправить неправильные заголовки ASF

  • [AIRFLOW-XXX] Добавить Zego в качестве пользователя Apache Airflow

  • [AIRFLOW-952] исправлено сохранение пустого дополнительного поля в пользовательском интерфейсе

  • [AIRFLOW-1325] Добавить обработчик и считыватель журнала ElasticSearch

  • [AIRFLOW-2301] Синхронизировать файлы ключа S3 с путем GCS

  • [AIRFLOW-2293] Исправить S3FileTransformOperator для работы с boto3

  • [AIRFLOW-3212] [AIRFLOW-2314] Удалить только ведущую косую черту в пути GCS

  • [AIRFLOW-1509] [AIRFLOW-442] Датчик SFTP

  • [AIRFLOW-2291] Добавить дополнительные параметры в ML Engine

  • [AIRFLOW-1774] Разрешить согласованный шаблон аргументов в MLEngineBatchPredictionOperator

  • [AIRFLOW-2302] Добавить недостающие операторы и крючки

  • [AIRFLOW-2312] Исправление опечаток в документации: Соответствует

  • [AIRFLOW-1623] Метод on_kill триггера в операторах

  • [AIRFLOW-2162] При олицетворении другого пользователя передайте переменные env в sudo

  • [AIRFLOW-2304] Обновите документ быстрого запуска, чтобы упомянуть часть планировщика

  • [AIRFLOW-1633] docker_operator требуется способ установить shm_size

  • [AIRFLOW-1340] Добавить S3 к оператору передачи Redshift

  • [AIRFLOW-2303] Перечисляет ключи внутри корзины S3

  • [AIRFLOW-2209] восстановить импорт flask_login

  • [AIRFLOW-2306] Добавить Bonnier Broadcasting в список текущих пользователей

  • [AIRFLOW-2305] [AIRFLOW-2027] Исправить сбой CI, вызванный []

  • [AIRFLOW-2281] Добавить поддержку для категорий Sendgrid

  • [AIRFLOW-2027] Запускать спящий режим в планировщике только после анализа всех файлов

  • [AIRFLOW-2256] SparkOperator: Добавить клиентский автономный режим и механизм повтора

  • [AIRFLOW-2284] GCS для оператора S3

  • [AIRFLOW-2287] Уведомления об обновлении лицензии

  • [AIRFLOW-2296] Добавить Cinimex DataLab в файл Readme

  • [AIRFLOW-2298] Добавьте Kalibrr к тем, кто использует Airflow

  • [AIRFLOW-2292] Исправить строку документации для S3Hook.get_wildcard_key

  • [AIRFLOW-XXX] Обновить шаблон PR

  • [AIRFLOW-XXX] Удалить устаревший migrations.sql

  • [AIRFLOW-2287] Добавить заголовок лицензии в документы / Makefile

  • [AIRFLOW-2286] Добавить tokopedia в readme

  • [AIRFLOW-2273] Добавить оператор / перехватчик веб-перехватчика Discord

  • [AIRFLOW-2282] Исправить грамматику в UPDATING.md

  • [AIRFLOW-2200] Добавить оператор снежинки с тестами

  • [AIRFLOW-2178] Добавить обработку ошибок пропуска SLA

  • [AIRFLOW-2169] Тип исправления «байты» не поддерживает сериализацию JSON в python3

  • [AIRFLOW-2215] Передать среду подпроцессу.Попен в base_task_runner

  • [AIRFLOW-2253] Добавить инструменты интерфейса командной строки Airflow

  • [AIRFLOW-2274] Исправить тесты потока данных

  • [AIRFLOW-2269] Добавить пользовательские чернила в качестве пользователя Airflow

  • [AIRFLOW-2259] Индекс перехвата потока данных вне допустимого диапазона

  • [AIRFLOW-2233] Обновите update.md, чтобы включить информацию о hdfs_sensors, переименовав

  • [AIRFLOW-2217] Добавить оператор веб-перехватчика Slack

  • [AIRFLOW-1729] улучшить время DagBag

  • [AIRFLOW-2264] Улучшение сообщения справки create_user cli

  • [AIRFLOW-2260] [AIRFLOW-2260] Шаблон команды добавления SSHOperator.sh файлы

  • [AIRFLOW-2261] Проверьте config / env для папки удаленного базового журнала

  • [AIRFLOW-2258] Разрешить импорт файлов формата Parquet в BigQuery

  • [AIRFLOW-1430] Включите инструкции INSTALL, чтобы избежать GPL

  • [AIRFLOW-1430] Устранение зависимости GPL

  • [AIRFLOW-2251] Добавить Thinknear в качестве пользователя Airflow

  • [AIRFLOW-2244] исправление: удаление устаревшего кода LongText из моделей.ру

  • [AIRFLOW-2247] Исправить RedshiftToS3Transfer, чтобы он не выходил из строя с ошибкой ValueError

  • [AIRFLOW-2249] Добавить поддержку боковой загрузки для Zendesk Hook

  • [AIRFLOW-XXX] Добавить Qplum пользователям Airflow

  • [AIRFLOW-2228] Улучшения в ValueCheckOperator

  • [AIRFLOW-1206] Опечатки

  • [AIRFLOW-2060] Обновление версии маятника до 1.4.4

  • [AIRFLOW-2248] Исправить неправильное имя параметра в документе RedshiftToS3Transfer

  • [AIRFLOW-1433] [AIRFLOW-85] Новый пользовательский интерфейс веб-сервера Airflow с поддержкой RBAC

  • [AIRFLOW-1235] Исправить странное поведение веб-сервера

  • [AIRFLOW-1460] Разрешить восстановление УДАЛЕННЫХ ТИ

  • [AIRFLOW-2235] Исправить неправильные строки документации в двух операторах

  • [AIRFLOW-XXX] Исправить хронологический порядок для компаний, использующих Airflow

  • [AIRFLOW-2124] Загрузить файл Python в корзину для Dataproc

  • [AIRFLOW-2212] Исправить негенерированный датчик Ссылка API

  • [AIRFLOW-2226] Переименовать google_cloud_storage_default в google_cloud_default

  • [AIRFLOW-2211] Переименуйте hdfs_sensors.py в hdfs_sensor.py для согласованности

  • [AIRFLOW-2225] Обновить документ, чтобы включить DruidDbApiHook

  • [Airflow-2202] Добавить поддержку фильтра в HiveMetastoreHook (). Max_partition ()

  • [AIRFLOW-2220] Удалить повторяющуюся запись числового списка в security.rst

  • [AIRFLOW-XXX] Обновить учебную документацию

  • [AIRFLOW-2215] Задача обновления сельдерея, чтобы сохранить переменные среды и улучшить ведение журнала при исключении

  • [AIRFLOW-2185] Использовать состояние вместо параметра запроса

  • [AIRFLOW-2183] Рефакторинг DruidHook для включения sql

  • [AIRFLOW-2203] Обнаружение цикла задержки

  • [AIRFLOW-2203] Удалить бесполезные команды.

  • [AIRFLOW-2203] Подпись кеша в apply_defaults

  • [AIRFLOW-2203] Ускорение ресурсов оператора

  • [AIRFLOW-2203] Статические правила кеширования (триггер / вес)

  • [AIRFLOW-2203] Сохранение идентификаторов задач в виде наборов, а не списков

  • [AIRFLOW-2205] Удаление неподдерживаемых аргументов из документа JdbcHook

  • [AIRFLOW-2207] Исправить нестабильный тест, в котором используется app.cached_app ()

  • [AIRFLOW-2206] Удаление неподдерживаемых аргументов из документа JdbcOperator

  • [AIRFLOW-2140] Добавить планировщик Kubernetes в SparkSubmitOperator

  • [AIRFLOW-XXX] Добавить Xero в список пользователей

  • [AIRFLOW-2204] Исправить режим отладки веб-сервера

  • [AIRFLOW-102] Исправить test_complex_template всегда успешно

  • [AIRFLOW-442] Добавить SFTPHook

  • [AIRFLOW-2169] Добавить схему в MySqlToGoogleCloudStorageOperator

  • [AIRFLOW-2184] [AIRFLOW-2138] Google Cloud Storage позволяет использовать подстановочные знаки

  • [AIRFLOW-1588] Преобразование значения переменной в строку

  • [AIRFLOW-2199] Исправить недопустимую ссылку на регистратор

  • [AIRFLOW-2191] Изменить журналы пульса планировщика с информации на отладку

  • [AIRFLOW-2106] Параметр песочницы с крючком SalesForce

  • [AIRFLOW-2197] Отключить сообщение об ошибке конфигурации hostname_callable

  • [AIRFLOW-2150] Используйте более легкий вызов в HiveMetastoreHook ().max_partition ()

  • [AIRFLOW-2186] Изменение способа ведения журнала за несколько операций

  • [AIRFLOW-2181] Преобразование password_auth и test_password_endpoints из DOS в UNIX

  • [AIRFLOW-2187] Исправить сломанный Travis CI из-за AIRFLOW-2123

  • [AIRFLOW-2175] Убедитесь, что путь к файлу не равен None

  • [AIRFLOW-2173] Не проверять идентификаторы задач на предмет достижения параллелизма, проверять

  • [AIRFLOW-2168] Удаленное ведение журнала для хранилища BLOB-объектов Azure

  • [AIRFLOW-XXX] Добавить DocuTAP в список пользователей

  • [AIRFLOW-2176] Изменить способ ведения журнала в BQ Get Data Operator

  • [AIRFLOW-2177] Добавить пробный тест для GCS Скачать op

  • [AIRFLOW-2123] Установите зависимости CI из программы установки.ру

  • [AIRFLOW-2129] Ловушка Presto вызывает _parse_exception_message, но определяет _get_pretty_exception_message

  • [AIRFLOW-2174] Исправить опечатки и неправильно оформленные документы

  • [AIRFLOW-2171] Хранить делегированные учетные данные

  • [AIRFLOW-2166] Восстановить параметр диалекта BQ run_query

  • [AIRFLOW-2163] Добавить HBC Digital пользователям Airflow

  • [AIRFLOW-2065] Исправить условия гонки при создании регистраторов

  • [AIRFLOW-2147] Диспетчер подключаемых модулей: добавлен атрибут «датчики»

  • [AIRFLOW-2059] запрос экземпляра задачи ужасен, не проиндексирован и не масштабируется

  • [AIRFLOW-2159] Исправить несколько опечаток в salesforce_hook

  • [AIRFLOW-2132] Добавить шаг для инициализации базы данных

  • [AIRFLOW-2160] Исправить неверную десериализацию rowid

  • [AIRFLOW-2161] Добавить Vevo в список компаний, использующих Airflow

  • [AIRFLOW-2149] Добавьте ссылку на документацию по apache Beam для создания самоисполняющегося Jar-файла

  • [AIRFLOW-2151] Разрешить получение сеанса от AwsHook

  • [AIRFLOW-2097] tz, на который имеется ссылка до присвоения

  • [AIRFLOW-2152] Добавить Multiply в список компаний, использующих Airflow

  • [AIRFLOW-1551] Добавить оператора для запуска задания Jenkins

  • [AIRFLOW-2034] Исправить смешение между% s и {} при использовании str.формат Соглашение заключается в использовании .format для форматирования строки вне журнала, иначе используйте ленивый формат См. комментарий в связанной проблеме https://github.com/apache/airflow/pull/2823/files Выявленный проблемный случай с использованием следующей командной строки .git / COMMIT_EDITMSG : grep -r '% s' ./* | grep ‘.format (‘

  • [AIRFLOW-2102] Добавить custom_args в персонализацию Sendgrid

  • [AIRFLOW-1035] [AIRFLOW-1053] импорт unicode_literals для синтаксического анализа Unicode в HQL

  • [AIRFLOW-2127] Хранить регистраторы во время миграции БД

  • [AIRFLOW-2146] Устранение проблем с BQ с помощью методов DbApiHook

  • [AIRFLOW-2087] Отчет планировщика показывает неверный общий номер задачи

  • [AIRFLOW-2139] Удалите ненужный шаблон, чтобы получить DataFrame с помощью pandas_gbq

  • [AIRFLOW-2125] Использование двоичного пакета psycopg2-binary

  • [AIRFLOW-2142] Включить сообщение об ошибке mkdir

  • [AIRFLOW-1615] SSHHook: использовать порт, указанный в соединении

  • [AIRFLOW-2122] Обрабатывать логические значения в sshHook

  • [AIRFLOW-XXX] Добавить плитку в список пользователей

  • [AIRFLOW-2130] Добавить отсутствующие операторы в справочные документы API

  • [AIRFLOW-XXX] Добавить единицы тайм-аута (секунды)

  • [AIRFLOW-2134] Добавьте Алана в список компаний, использующих Airflow

  • [AIRFLOW-2133] Удалите ссылки на проблемы GitHub в СОДЕРЖАНИИ

  • [AIRFLOW-2131] Устранение сбивающих с толку документов AirflowImport

  • [AIRFLOW-1852] Разрешить переопределение имени хоста.

  • [AIRFLOW-2126] Добавить Bluecore активным пользователям

  • [AIRFLOW-1618] Добавить функцию для создания сегмента GCS

  • [AIRFLOW-2108] Исправить отступ журнала в BashOperator

  • [AIRFLOW-2115] Исправить ссылки в документах на PythonHosted

  • [AIRFLOW-XXX] Добавить участника из компании Easy

  • [AIRFLOW-1882] Добавить параметр ignoreUnknownValues ​​в оператор gcs_to_bq

  • [AIRFLOW-2089] Добавление уничтожения для SparkSubmit в автономном кластере

  • [AIRFLOW-2113] Отсутствует адрес обратных вызовов DagRun. Учитывая, что метод handle_callback принадлежит объекту DAG, мы можем получить список задач напрямую с помощью get_task и уменьшить взаимодействие с базой данных, что делает Airflow более легким.

  • [AIRFLOW-2112] Исправлена ​​ширина svg для недавних задач в пользовательском интерфейсе.

  • [AIRFLOW-2116] Установить версию CI Cloudant на <2.0

  • [AIRFLOW-XXX] Добавить PMC в список компаний, использующих Airflow

  • [AIRFLOW-2100] Исправить неработающие ссылки на документацию

  • [AIRFLOW-1404] Добавить «flatten_results» и «maximum_bytes_billed» в BQ Operator

  • [AIRFLOW-800] Инициализировать действительное соединение Google BigQuery

  • [AIRFLOW-1319] Исправление вводящей в заблуждение строки документации SparkSubmitOperator и SparkSubmitHook

  • [AIRFLOW-1983] Анализировать параметр среды как шаблон

  • [AIRFLOW-2095] Добавить оператор для создания внешней таблицы BigQuery

  • [AIRFLOW-2085] Добавить оператора SparkJdbc

  • [AIRFLOW-1002] Добавлена ​​возможность очистки всех зависимостей от удаленного DAG

  • [AIRFLOW-2094] Jinjafied project_id, region & zone в DataProc {*} Операторы

  • [AIRFLOW-2092] Исправлен неверный параметр в строке документации для FTPHook

  • [AIRFLOW-XXX] Добавить SocialCops для пользователей Airflow

  • [AIRFLOW-2088] Исправить повторяющиеся ключи в MySQL для функции GCS Helper

  • [AIRFLOW-2091] Исправить неверный параметр строки документации в BigQuery Hook

  • [AIRFLOW-2090] Исправить опечатку в DataStore Hook

  • [AIRFLOW-1157] Исправить отсутствующие пулы, приводящие к сбою планировщика

  • [AIRFLOW-713] Jinjafy {EmrCreateJobFlow, EmrAddSteps} Атрибуты оператора

  • [AIRFLOW-2083] Документы: используйте «его» вместо «оно», где это уместно.

  • [AIRFLOW-2066] Добавить оператор для создания пустой таблицы BQ

  • [AIRFLOW-XXX] добавить Karmic в список компаний

  • [AIRFLOW-2073] Сбой FileSensor, если файл не существует

  • [AIRFLOW-2078] Повышение производительности task_stats и dag_stats

  • [AIRFLOW-2080] Используйте значок выхода вместо кнопки питания

  • [AIRFLOW-2077] Получить все страницы ответа list_objects_v2

  • [AIRFLOW-XXX] Добавить TM в список компаний

  • [AIRFLOW-1985] Исправления олицетворения для использования run_as_user

  • [AIRFLOW-2018] [AIRFLOW-2] Обеспечение обратной совместимости датчиков

  • [AIRFLOW-XXX] Исправить опечатку в концептуальном документе (dag_md)

  • [AIRFLOW-2069] Разрешить загрузку байтов в S3

  • [AIRFLOW-2074] Исправить имя переменной журнала в аутентификации GHE

  • [AIRFLOW-1927] Преобразование простого времени для TaskInstances

  • [AIRFLOW-1760] Пароль аутентификации для экспериментального API

  • [AIRFLOW-2038] Добавить недостающую зависимость Kubernetes для разработчика

  • [AIRFLOW-2040] Исключить специальные символы в журналах экземпляров задач URL

  • [AIRFLOW-1968] [AIRFLOW-1520] Добавить поддержку role_arn и aws_account_id / aws_iam_role обратно в обработчик aws

  • [AIRFLOW-2048] Исправить форматирование строки ошибки экземпляра задачи

  • [AIRFLOW-2046] Исправить ошибку kerberos для работы с Python 3.х

  • [AIRFLOW-2063] Добавить недостающие документы для GCP

  • [AIRFLOW-XXX] Исправить опечатку в документации

  • [AIRFLOW-1793] Используйте docker_url вместо недопустимого base_url

  • [AIRFLOW-2055] Разработка немного неоднозначной документации

  • [AIRFLOW-2039] BigQueryOperator поддерживает свойство приоритета

  • [AIRFLOW-2053] Исправлена ​​ошибка символа кавычки в обработчике BQ

  • [AIRFLOW-2057] Добавить запасы в список компаний

  • [AIRFLOW-XXX] Добавить Plaid пользователям Airflow

  • [AIRFLOW-2044] Добавить SparkSubmitOperator в документацию

  • [AIRFLOW-2037] Добавить методы для получения значений хэша объекта GCS

  • [AIRFLOW-2050] Исправить проблему с разрешением Travis

  • [AIRFLOW-2043] Добавить домофон в список компаний

  • [AIRFLOW-2023] Добавить журнал отладки вокруг количества файлов в очереди

  • [AIRFLOW-XXX] Добавить Пернод-Рикарда в качестве пользователя Airflow

  • [AIRFLOW-1453] Добавьте «шаги» в template_fields в EmrAddSteps

  • [AIRFLOW-2015] Добавить флаг для интерактивных запусков

  • [AIRFLOW-1895] Исправить целостность первичного ключа для mysql

  • [AIRFLOW-2030] Исправить KeyError: i в DbApiHook для вставки

  • [AIRFLOW-1943] Добавить функцию внешней таблицы BigQuery

  • [AIRFLOW-2033] Добавить оператора списка облачных хранилищ Google

  • [AIRFLOW-2006] Добавить локальный лог для оператора kubernetes

  • [AIRFLOW-2031] Добавьте отсутствующий gcp_conn_id в примере в строки документации DataFlow

  • [AIRFLOW-2029] Исправить ошибку AttributeError в BigQueryPandasConnector

  • [AIRFLOW-2028] Добавить JobTeaser в список официальных пользователей

  • [AIRFLOW-2016] Добавить поддержку шаблонов рабочего процесса Dataproc

  • [AIRFLOW-2025] Пониженная детализация журнала

  • [AIRFLOW-1267] [AIRFLOW-1874] Добавить параметр диалекта в BigQueryHook

  • [AIRFLOW-XXX] Исправлена ​​опечатка

  • [AIRFLOW-XXX] Тип узла к узлам

  • [AIRFLOW-2019] Обновление DataflowHook для обновления задания типа потоковой передачи

  • [AIRFLOW-2017] [Airflow 2017] добавление вывода запроса в PostgresOperator

  • [AIRFLOW-1889] Разделить датчики на отдельные файлы

  • [AIRFLOW-1950] Необязательно передать xcom_pull task_ids

  • [AIRFLOW-1755] Разрешить монтирование ниже корня

  • [AIRFLOW-511] [Airflow 511] добавить обратные вызовы успеха / неудачи на уровне dag

  • [AIRFLOW-192] Добавить параметр weight_rule в BaseOperator

  • [AIRFLOW-2008] Использовать вызываемый для столбца Python значения по умолчанию

  • [AIRFLOW-1984] Исправление для оператора AWS Batch

  • [AIRFLOW-2000] Поддержка класса задания неосновного потока данных

  • [AIRFLOW-2003] Использовать flask-caching вместо flask-cache

  • [AIRFLOW-2002] Не принимать исключение при импорте журнала

  • [AIRFLOW-2004] Импортировать flash из колбы, а не из колбы.логин

  • [AIRFLOW-1997] Исправить строки документа оператора GCP

  • [AIRFLOW-1996] Обновление DataflowHook wait_for_done для задания типа Streaming

  • [AIRFLOW-1995] [Airflow 1995] добавить метод on_kill в SqoopOperator

  • [AIRFLOW-1770] Разрешить HiveOperator принимать файл

  • [AIRFLOW-1994] Изменить цвет фона для экземпляров задач запланированного состояния

  • [AIRFLOW-1436] [AIRFLOW-1475] EmrJobFlowSensor считает отмененный шаг как успешный

  • [AIRFLOW-1517] Исправления PR оператора Kubernetes

  • [AIRFLOW-1517] Адресованные PR-комментарии

  • [AIRFLOW-1517] Запущена документация оператора k8s

  • [AIRFLOW-1517] Восстановить авторство ресурсов

  • [AIRFLOW-1517] Снять авторство ресурсов

  • [AIRFLOW-1517] Добавить minikube для интеграционных тестов kubernetes

  • [AIRFLOW-1517] Восстановить авторство ресурсов

  • [AIRFLOW-1517] исправленные проблемы с лицензией

  • [AIRFLOW-1517] Созданы более точные сбои для проблем кластера куба

  • [AIRFLOW-1517] Снять авторство ресурсов

  • [AIRFLOW-1517] Добавить minikube для интеграционных тестов kubernetes

  • [AIRFLOW-1988] Изменить цвет BG при отсутствии состояния TI

  • [AIRFLOW-790] Очистить экземпляры задач без DagRuns

  • [AIRFLOW-1949] Исправьте загрузку переменных, str () выдает «b’… ’», которое не является json

  • [AIRFLOW-1930] Конвертировать функ.now () в timezone.utcnow ()

  • [AIRFLOW-1688] Поддержка load.time_partitioning в bigquery_hook

  • [AIRFLOW-1975] Сделать обратный вызов TriggerDagRunOperator необязательным

  • [AIRFLOW-1480] Атрибуты шаблона визуализации для полей ExternalTaskSensor

  • [AIRFLOW-1958] Добавить kwargs в send_email

  • [AIRFLOW-1976] Исправление отсутствия атрибута журнала / регистратора FileProcessHandler

  • [AIRFLOW-1982] Исправить форматирование журнала событий Executor

  • [AIRFLOW-1971] Распространение конфигурации куста при олицетворении

  • [AIRFLOW-1969] Всегда использовать HTTPS URI для Google OAuth3

  • [AIRFLOW-1954] Добавить DataFlowTemplateOperator

  • [AIRFLOW-1963] Добавить конфигурацию для HiveOperator mapred_queue

  • [AIRFLOW-1946] [AIRFLOW-1855] Создание оператора получения данных BigQuery

  • [AIRFLOW-1953] Добавить метки к операторам потока данных

  • [AIRFLOW-1967] Обновите сельдерей до 4.0,2

  • [AIRFLOW-1964] Добавить Upsight в список пользователей Airflow

  • [AIRFLOW-XXX] Список изменений для 1.9.0

  • [AIRFLOW-1470] Внедрить оператор BashSensor

  • [AIRFLOW-XXX] Закрепить зависимость sqlalchemy

  • [AIRFLOW-1955] Не ссылаться на неназначенную переменную

  • [AIRFLOW-1957] Добавьте участника BalanceHero в Readme

  • [AIRFLOW-1517] Восстановить авторство секретов и контейнера инициализации

  • [AIRFLOW-1517] Снять авторство секретов и контейнер инициализации

  • [AIRFLOW-1935] Добавить BalanceHero в readme

  • [AIRFLOW-1939] добавить участников-астрономов

  • [AIRFLOW-1517] Оператор Kubernetes

  • [AIRFLOW-1928] Исправить @once с catchup = False

  • [AIRFLOW-1937] Ускорьте планирование, выполнив пакетную фиксацию

  • [AIRFLOW-1821] Улучшить конфигурацию ведения журнала по умолчанию, удалив лишние регистраторы

  • [AIRFLOW-1904] Исправьте расположение файла DAG по правильному пути

  • [AIRFLOW-1909] Обновите документацию с учетом поддерживаемых версий сервера MySQL

  • [AIRFLOW-1915] Спецификация зависимостей Relax flask-wtf

  • [AIRFLOW-1920] Обновление ДОПОЛНИТЕЛЬНО.md, чтобы отразить обязательные правила линтинга

  • [AIRFLOW-1942] Обновление документации Sphinx для удаления устаревшей структуры импорта

  • [AIRFLOW-1846] [AIRFLOW-1697] Скрыть специальный запрос за конфигурацией secure_mode

  • [AIRFLOW-1948] Включить подробную информацию о сбое on_kill

  • [AIRFLOW-1938] Очистить неиспользуемое исключение

  • [AIRFLOW-1932] Добавить GCP Pub / Sub Pull и Ack

  • [AIRFLOW-XXX] Комбинезон продувки

  • [AIRFLOW-XXX] Удалить неиспользованный жетон спецодежды

  • [AIRFLOW-1938] Удаление проверки версии тега в настройке.ру

  • [AIRFLOW-1916] Не загружать журналы на удаленный компьютер из run –raw

  • [AIRFLOW-XXX] Исправить неудачные тесты PubSub на Python3

  • [AIRFLOW-XXX] Обновите до Python 3.5 и отключите тесты dask

  • [AIRFLOW-1913] Добавить новые операторы GCP PubSub

  • [AIRFLOW-1525] Устранение мелких проблем с ЛИЦЕНЗИЕЙ и УВЕДОМЛЕНИЕМ

  • [AIRFLOW-1687] исправить ошибку фернета без шифрования

  • [AIRFLOW-1912] воздушный поток.процессор не должен распространять журнал

  • [AIRFLOW-1911] Переименовать celeryd_concurrency

  • [AIRFLOW-1885] Исправить ошибку IndexError в ready_prefix_on_cmdline

  • [AIRFLOW-1854] Улучшение оператора Spark Submit для автономного кластерного режима

  • [AIRFLOW-1908] Исправить загрузку конфигурации параметров брокера сельдерея

  • [AIRFLOW-1907] Передать max_ingestion_time ловушке Druid

  • [AIRFLOW-1909] Добавить в список пользователей

  • [AIRFLOW-1893] [AIRFLOW-1901] Распространение PYTHONPATH при использовании олицетворения

  • [AIRFLOW-1892] Изменить обработчик BQ для извлечения данных, отфильтрованных по столбцу

  • [AIRFLOW-1829] Поддержка обновлений схемы в заданиях запросов

  • [AIRFLOW-1840] Сделайте конфигурацию сельдерея совместимой с сельдереем 4

  • [AIRFLOW-1878] Исправить перенаправление stderr / stdout для задач

  • [AIRFLOW-1897] [AIRFLOW-1873] Журналы задач для запущенного экземпляра не отображаются в WebUI

  • [AIRFLOW-1896] FIX bleach <> несовместимость html5lib

  • [AIRFLOW-1884] [AIRFLOW-1059] Сбросить состояние потерянной задачи для внешних дагрунов

  • [AIRFLOW-XXX] Исправить опечатку в комментарии

  • [AIRFLOW-1869] Не выдавать ложное предупреждение об отсутствующих журналах

  • [AIRFLOW-1888] Добавить датчик кластера AWS Redshift

  • [AIRFLOW-1887] Переименованная переменная URL-адреса конечной точки

  • [AIRFLOW-1873] Установить TI.try_number на правильное значение в зависимости от состояния TI

  • [AIRFLOW-1891] Исправить опечатку, отличную от ascii, в шаблоне конфигурации по умолчанию

  • [AIRFLOW-1879] Полностью обрабатывать журнал в пределах

  • [AIRFLOW-1869] Записывать больше сообщений об ошибках в gcs и журналы файлов

  • [AIRFLOW-1876] Записать идентификатор подзадачи в заголовок журнала задач

  • [AIRFLOW-1554] Исправить неправильный вызов метода завершения DagFileProcessor

  • [AIRFLOW-342] Не использовать amqp, rpc в качестве серверной части результата

  • [AIRFLOW-966] Сделать celery broker_transport_options настраиваемым

  • [AIRFLOW-1881] Сделать лог оператора в журнале задач

  • [AIRFLOW-XXX] Добавлен DataReply в список пользователей Airflow

  • [AIRFLOW-1883] Получить размер файла для объектов в Google Cloud Storage

  • [AIRFLOW-1872] Установить контекст для всех обработчиков, включая родителей

  • [AIRFLOW-1855] [AIRFLOW-1866] Добавить оператора копирования GCS для копирования нескольких файлов

  • [AIRFLOW-1870] Включить тесты flake8

  • [AIRFLOW-1785] Включить тесты Python 3

  • [AIRFLOW-1850] Копировать cmd перед маскированием

  • [AIRFLOW-1665] Повторное подключение при ошибках базы данных

  • [AIRFLOW-1559] Удаление ядер SQLAlchemy на выходе

  • [AIRFLOW-1559] Закрыть дескрипторы файлов в подпроцессах

  • [AIRFLOW-1559] Сделать пул базы данных необязательным

  • [AIRFLOW-1848] [Airflow-1848] Исправить DataFlowPythonOperator, расширение py_file, комментарий документа

  • [AIRFLOW-1843] Добавить датчик облачного хранилища Google с префиксом

  • [AIRFLOW-1803] Документация по часовому поясу

  • [AIRFLOW-1826] Обновить представления для использования объектов с учетом часового пояса

  • [AIRFLOW-1827] Исправить синтаксический анализ даты конечной точки API

  • [AIRFLOW-1806] Использовать простую дату и время при использовании cron

  • [AIRFLOW-1809] Обновить тесты для использования объектов с учетом часового пояса

  • [AIRFLOW-1806] Использовать простую дату и время для планирования cron

  • [AIRFLOW-1807] Принудительное использование полей базы данных с учетом часового пояса

  • [AIRFLOW-1808] Преобразовать все utcnow () в часовой пояс

  • [AIRFLOW-1804] Добавить параметры конфигурации часового пояса

  • [AIRFLOW-1802] Преобразование полей базы данных с учетом часового пояса

  • [AIRFLOW-XXX] Добавить файлы блокировки dask для исключения

  • [AIRFLOW-1790] Добавить поддержку для оператора AWS Batch

  • [AIRFLOW-XXX] Обновите README.мкр

  • [AIRFLOW-1820] Удалить отметку времени из названия метрики

  • [AIRFLOW-1810] Удалите неиспользуемый импорт mysql в миграциях.

  • [AIRFLOW-1838] Правильно регистрировать исключение collect_dags

  • [AIRFLOW-1842] Исправлено имя суперкласса для оператора копирования gcs в gcs

  • [AIRFLOW-1845] Модальный фон теперь покрывает длинные или высокие страницы

  • [AIRFLOW-1229] Добавить ссылку на идентификатор запуска, включая дату выполнения

  • [AIRFLOW-1842] Добавить gcs в оператор копирования gcs с переименованием, если требуется

  • [AIRFLOW-1841] изменить False на None в операторе и крюке

  • [AIRFLOW-1839] Исправить больше ошибок в S3Hook boto -> миграция boto3

  • [AIRFLOW-1830] Поддержка нескольких доменов в серверной части аутентификации Google

  • [AIRFLOW-1831] Добавить искру для пути к классу драйвера, отправить

  • [AIRFLOW-1795] Правильно вызовите S3Hook после миграции на boto3

  • [AIRFLOW-1811] Исправить рендеринг оператора Druid

  • [AIRFLOW-1819] Исправить ошибку unittest оператора слабины

  • [AIRFLOW-1805] Разрешить передачу токена Slack через соединение

  • [AIRFLOW-1816] Добавить параметр региона в операторы Dataproc

  • [AIRFLOW-868] Добавить оператор postgres_to_gcs и unittests

  • [AIRFLOW-1613] сделать mysql_to_gcs_operator py3 совместимым

  • [AIRFLOW-1817] использовать boto3 для зависимости s3

  • [AIRFLOW-1813] Ошибка оператора SSH пустой буфер

  • [AIRFLOW-1801] [AIRFLOW-288] URL-адрес кодирования дат выполнения

  • [AIRFLOW-1563] Перехватить OSError при символической ссылке на последний каталог журнала

  • [AIRFLOW-1794] Удалить использование исключения.сообщение для Python 3

  • [AIRFLOW-1799] Исправить строку журнала, которая вызывает ошибки

  • [AIRFLOW-1102] Модернизация Gunicorn> = 19.4.0

  • [AIRFLOW-1756] Исправить S3TaskHandler для работы с S3Hook на основе Boto3

  • [AIRFLOW-1797] S3Hook.load_string не работал на Python3

  • [AIRFLOW-646] Добавить документы в setup_requires

  • [AIRFLOW-1792] Отсутствующие интервалы DruidOperator

  • [AIRFLOW-1789] [AIRFLOW-1712] Записать SSHOperator stderr в журнал.предупреждение

  • [AIRFLOW-1787] Пакетная очистка экземпляра задачи и ошибки установки состояния

  • [AIRFLOW-1780] Исправить длинные выходные строки с Unicode от висящего родительского элемента

  • [AIRFLOW-387] Правильно закрыть сеансы SQLAlchemy

  • [AIRFLOW-1779] Добавить пакеты keepalive в ловушку ssh

  • [AIRFLOW-1669] Исправить Docker и закрепить мото на 1.1.19

  • [AIRFLOW-71] Добавить поддержку частных образов Docker

  • [AIRFLOW-XXX] Подскажите, что такое переменная «ds»

  • [AIRFLOW-XXX] Исправьте опечатки на странице часто задаваемых вопросов.

  • [AIRFLOW-1571] Добавить AWS Lambda Hook

  • [AIRFLOW-1675] Исправить строки документации для документов API

  • [AIRFLOW-1712] [AIRFLOW-756] [AIRFLOW-751] Журнал SSH Выход оператора

  • [AIRFLOW-1776] Захват stdout и stderr для ведения журнала

  • [AIRFLOW-1765] Сделайте экспериментальный API защищаемым без использования Kerberos.

  • [AIRFLOW-1764] Веб-интерфейс не должен использовать экспериментальный API

  • [AIRFLOW-1771] Переименуйте контрольный сигнал, чтобы избежать путаницы

  • [AIRFLOW-1769] Добавить поддержку шаблонов в VirtualenvOperator

  • [AIRFLOW-1763] Исправить модульные тесты S3TaskHandler

  • [AIRFLOW-1315] Добавить Qubole File & Partition Sensors

  • [AIRFLOW-1018] Заставить процессор использовать среду ведения журналов

  • [AIRFLOW-1695] Добавить RedshiftHook с помощью boto3

  • [AIRFLOW-1706] Исправить ошибку запроса для серверной части MSSQL

  • [AIRFLOW-1711] Использовать ldap3 dict для членства в группе

  • [AIRFLOW-1723] Сделать sendgrid надстройкой

  • [AIRFLOW-1757] Добавить отсутствующие параметры в SparkSubmitOperator

  • [AIRFLOW-1734] [Airflow 1734] Sqoop-крючок / дополнительные возможности оператора

  • [AIRFLOW-1761] Исправить тип в планировщике.первый

  • [AIRFLOW-1731] Установить путь к python для ведения журнала

  • [AIRFLOW-1641] Обработка событий исполнителя в планировщике

  • [AIRFLOW-1744] Убедитесь, что можно установить max_tries

  • [AIRFLOW-1732] Улучшение регистрации обработчиков потока данных

  • [AIRFLOW-1736] Быстрое добавление гостиницы к тем, кто использует воздушный поток

  • [AIRFLOW-1657] Обработать отказавший оператор кубола

  • [AIRFLOW-1677] Исправить опечатку в example_qubole_operator

  • [AIRFLOW-926] Исправить крючок JDBC

  • [AIRFLOW-1520] Boto3 S3Hook, S3Log

  • [AIRFLOW-1716] Исправить несколько __init__ def в SimpleDag

  • [AIRFLOW-XXX] Исправить дату и время в древовидной структуре

  • [AIRFLOW-1719] Исправить небольшую опечатку

  • [AIRFLOW-1432] Ярлык диаграммы для оси Y не виден

  • [AIRFLOW-1743] Проверьте правильность фильтров LDAP

  • [AIRFLOW-1745] Восстановить расположение сигнала по умолчанию

  • [AIRFLOW-1741] Правильно скрыть вторую диаграмму на странице длительности задачи

  • [AIRFLOW-1728] Добавить networkUri, subnet, tags к оператору Dataproc

  • [AIRFLOW-1726] Добавить метод copy_expert psycopg2 в PostgresHook

  • [AIRFLOW-1330] Добавить аргумент conn_type в интерфейс командной строки при добавлении соединения

  • [AIRFLOW-1698] Удалить переменную env SCHEDULER_RUNS в systemd

  • [AIRFLOW-1694] Прекратите использование itertools.izip

  • [AIRFLOW-1692] Измените имя файла test_views для поддержки Windows

  • [AIRFLOW-1722] Исправить опечатку в автоматическом перезапуске планировщика имя файла

  • [AIRFLOW-1723] Поддержка sendgrid в серверной части электронной почты

  • [AIRFLOW-1718] Установить num_retries при выполнении запроса задания Dataproc

  • [AIRFLOW-1727] Добавить модульные тесты для DataProcHook

  • [AIRFLOW-1631] Устранение проблемы синхронизации в модульном тесте

  • [AIRFLOW-1631] Исправить несвязанный параллелизм локального исполнителя

  • [AIRFLOW-1724] Добавить Fundera в список «Кто использует Airflow?»

  • [AIRFLOW-1683] Отменить задание BigQuery по истечении времени ожидания.

  • [AIRFLOW-1714] Исправить орфографические ошибки: s / отдельный / отдельный /

  • [AIRFLOW-1681] Добавить пакетную очистку в представлении экземпляра задачи

  • [AIRFLOW-1696] Исправить ошибку метки версии dataproc

  • [AIRFLOW-1613] Обработка двоичного поля в MySqlToGoogleCloudStorageOperator

  • [AIRFLOW-1697] Режим отключения конечной точки графиков

  • [AIRFLOW-1691] Добавьте лучшую документацию по ведению журнала в облаке Google

  • [AIRFLOW-1690] Добавить детали в сообщения об ошибках gcs

  • [AIRFLOW-1682] Заставить S3TaskHandler записывать на S3 при закрытии

  • [AIRFLOW-1634] Добавляет функцию task_concurrency

  • [AIRFLOW-1676] Заставить GCSTaskHandler записывать в GCS при закрытии

  • [AIRFLOW-1678] Исправить ошибочно повторяющееся слово в функциональных строках документации

  • [AIRFLOW-1323] Согласованы имена параметров оператора Dataproc

  • [AIRFLOW-1590] исправить неиспользуемый модуль и переменную

  • [AIRFLOW-1671] Добавить @apply_defaults обратно в оператор загрузки gcs

  • [AIRFLOW-988] Исправить повторяющиеся обратные вызовы пропуска SLA

  • [AIRFLOW-1611] Настроить ведение журнала

  • [AIRFLOW-1668] Предоставить keepalives_idle для соединений Postgres

  • [AIRFLOW-1658] Убить задачу друида по таймауту

  • [AIRFLOW-1669] [AIRFLOW-1368] Исправить импорт Docker

  • [AIRFLOW-891] Включить в часы веб-сервера дату

  • [AIRFLOW-1560] Добавить обработчик и оператор AWS DynamoDB для вставки элементов партии

  • [AIRFLOW-1654] Показать всплывающие подсказки для значков ссылок в представлении DAG

  • [AIRFLOW-1660] Изменить ширину веб-страницы на полную

  • [AIRFLOW-1664] записать файл как двоичный вместо str

  • [AIRFLOW-1659] Исправлена ​​ошибка неверного атрибута obj в file_task_handler.ру

  • [AIRFLOW-1635] Разрешить создание подключения к GCP без необходимости файла JSON

  • [AIRFLOW-1650] Исправить загрузку пользовательской конфигурации сельдерея

  • [AIRFLOW-1647] Исправить крючок Spark-sql

  • [AIRFLOW-1587] Исправить ошибку импорта CeleryExecutor

  • [Airflow-1640] [AIRFLOW-1640] Добавить соединение qubole по умолчанию

  • [AIRFLOW-1576] Добавлен параметр региона в Dataproc {*} Операторы

  • [AIRFLOW-1643] Добавить Healthjump к официально используемому списку

  • [AIRFLOW-1626] Добавить решения Azri пользователям Airflow

  • [AIRFLOW-1636] Добавьте тип соединения AWS и EMR

  • [AIRFLOW-1527] Рефакторинг конфигурации celery

  • [AIRFLOW-1639] Исправить обработку ошибок Fernet

  • [AIRFLOW-1637] Ссылка на статус сборки Travis CI

  • [AIRFLOW-1628] Исправить строку документации sqlsensor

  • [AIRFLOW-1331] добавить опцию SparkSubmitOperator

  • [AIRFLOW-1627] Только пул запросов в инициализации SubDAG при необходимости

  • [AIRFLOW-1629] Добавить текстовое поле в форме редактирования соединений

  • [AIRFLOW-1368] Автоматически удалять контейнер Docker при выходе

  • [AIRFLOW-289] Сделать воздушный поток независимым от часового пояса

  • [AIRFLOW-1356] Добавьте –celery_hostname к airflow worker

  • [AIRFLOW-1247] Исправить игнорирование аргумента ignore_all_dependencies

  • [AIRFLOW-1621] Добавить тесты для подкачки на стороне сервера

  • [AIRFLOW-1591] Избегайте ошибки атрибута при рендеринге журнала имя файла

  • [AIRFLOW-1031] Заменить жесткий код на DagRun.ID_PREFIX

  • [AIRFLOW-1604] Переименовать регистратор в журнал

  • [AIRFLOW-1512] Добавить PythonVirtualenvOperator

  • [AIRFLOW-1617] Исправить уязвимость XSS в конечной точке переменной

  • [AIRFLOW-1497] Сброс скрытых полей при изменении типа соединения

  • [AIRFLOW-1619] Добавить параметр poll_sleep в оператор потока данных GCP

  • [AIRFLOW-XXX] Удалить конфигурацию landscape.io

  • [AIRFLOW-XXX] Удалить значки неработающих сервисных служб

  • [AIRFLOW-1177] Исправить переменную.setdefault с существующим JSON

  • [AIRFLOW-1600] Исправить обработку исключений в get_fernet

  • [AIRFLOW-1614] Замените inspect.stack () на sys._getframe ()

  • [AIRFLOW-1519] Добавить подкачку на стороне сервера в список DAG

  • [AIRFLOW-1309] Разрешить hive_to_druid принимать tblproperties

  • [AIRFLOW-1613] Сделайте MySqlToGoogleCloudStorageOperator совместимым с python3

  • [AIRFLOW-1603] добавить PAYMILL в список компаний

  • [AIRFLOW-1609] Исправить gitignore, чтобы игнорировать все venvs

  • [AIRFLOW-1601] Добавить настраиваемое время очистки задачи

  • .

    Автор: alexxlab

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *